SpLitteR is a tool that uses synthetic long reads (SLRs) to improve the contiguity of HiFi assemblies. Given a SLR library and a HiFi assembly graph in the GFA format, SpLitteR resolves repeats in the assembly graph using linked-reads and generates a simplified (more contiguous) assembly graph with corresponding scaffolds.

• g++ (version 5.3.1 or higher)
• cmake (version 3.12 or higher)
• zlib
• libbz2

cd spades/assembler/
mkdir build && cd build && cmake ../src
make splitter

Now to run SpLitteR move to folder assembler/ and execute

build/bin/splitter

The tool requires

• Assembly graph file in GFA 1.0 format, with scaffolds included as path lines.
• SLR library in YAML format. The tool supports SLR libraries produced using 10X Genomics Chromium and UST TELL-Seq technologies. Other SLR technologies, such as stLFR or LoopSeq can potentially be used as an input if converted to 10X or TELL-Seq format.

SpLitteR supports LJA and Flye assembly graphs out of the box. Other assembly graphs should prefferably be converted into blunt format by e.g. GetBlunted utility.

TELL-Seq library should include barcodes, left reads, and right reads as three separate FASTQ files.

For example, if you have a TELL-Seq library

    tellseq_reads_I1.fastq.gz
    tellseq_reads_R1.fastq.gz
    tellseq_reads_R2.fastq.gz

YAML file should look like this:

    [
      {
        orientation: "fr",
        type: "tell-seq",
        right reads: [
          "/FULL_PATH_TO_DATASET/tellseq_reads_R2.fastq.gz"
        ],
        left reads: [
          "/FULL_PATH_TO_DATASET/tellseq_reads_R1.fastq.gz"
        ],
        aux: [
          "/FULL_PATH_TO_DATASET/tellseq_reads_I1.fastq.gz"
        ]
      }
    ]

10X library should be in FASTQ format with barcodes attached as BC:Z or BX:Z tags:

@COOPER:77:HCYNTBBXX:1:1216:22343:0 BX:Z:AAAAAAAAAACATAGT
CCAGGTAGGATTATGGAATTGGTATAAGCGATCAAACTCAATATTTTTGGTGCGGTGACAGACGCCTTCTGGCAGATGATGGGCTTGTCGTAAGTGTGGT
+
GGAGGGAAGGGGIGIIAGAGAGGGGGIAGGGGGGGAGGGGGGGGGGGGAAAGGAGGGGGIGIGGGGGGGAGGAGGIGAIAGGIGGGGIGGGGGGGGGGGG

For example, if you have an SLR library

    lib_slr_1.fastq.gz
    lib_slr_2.fastq.gz

YAML file should look like this:

    [
      {
        orientation: "fr",
        type: "clouds10x",
        right reads: [
          "/FULL_PATH_TO_DATASET/lib_slr_2.fastq.gz" 
        ],
        left reads: [
          "/FULL_PATH_TO_DATASET/lib_slr_1.fastq.gz"
        ]
      }
    ]

Synopsis: splitter <graph (in binary or GFA)> <SLR library description (in YAML)> <path to output directory> [OPTION...]

Main options:

• -t Number of threads to use (default: 1/2 of available threads)
• --mapping-k k-mer length for read mapping (default: 31)
• -Gmdbg|-Gblunt Assembly graph type: mDBG (LJA) or blunted (Flye)
• -Mdiploid|-Mmeta Repeat resolution mode (diploid or meta)
• --assembly-info Path to metaFlye assembly_info.txt file (meta mode, metaFlye graphs only)

Barcode index construction:

• --count-threshold Minimum number of reads for barcode index
• --frame-size Resolution of the barcode index
• --length-threshold Minimum scaffold graph edge length (meta mode option)
• --linkage-distance Reads are assigned to the same fragment on long edges based on the linkage distance
• --min-read-threshold Minimum number of reads for path cluster extraction
• --relative-score-threshold Relative score threshold for path cluster extraction
• --sampling-factor Downsample input SLR reads by this factor

Repeat resolution:

• --score Score threshold for link index.
• --tail-threshold Barcodes are assigned to the first and last <tail_threshold> nucleotides of the edge.
• --scaffold-links Use scaffold links in addition to graph links for repeat resolution

Developer options:

• --ref Reference path for repeat resolution evaluation
• --bin-load Load read-to-graph alignment
• --debug Produce lots of debug data, save read-to-graph alignment
• --tmp-dir Scratch directory to use
• -h, --help Print help message

Example command lines:

• Assembly produced LJA from HiFi diploid human dataset, with 10X SLR library (HPC compressed)
  splitter lja_output/mdbg/mdbg.hpc.gfa 10x_dataset.yaml output -Mdiploid -Gmdbg
• Assembly produced by metaFlye from metagenomic dataset, with TELL-Seq SLR library
  splitter metaflye_output/assembly_graph.gfa tellseq_dataset.yaml output --assembly-info metaflye_output/assembly_info.txt -Mmeta -Gblunt

SpLitteR stores all output files in output directory <output_dir> , which is set by the user.

• <output_dir>/assembly_graph.gfa input assembly graph in mDBG encoding
• <output_dir>/resolved_graph.gfa output assembly graph after repeat resolution
• <output_dir>/contigs.fasta output scaffolds

In addition

• <output_dir>/edge_transform.tsv map from input graph edges to resolved graph edges
• <output_dir>/vertex_stats.tsv Statistics for complex vertices
• <output_dir>/resolved_graph.fasta Sequences of the resolved graph edges