Lv & Chen

Tropical Journal of Pharmaceutical Research December 2017; 16 (12): 2895-2901

ISSN: 1596-5996 (print); 1596-9827 (electronic)
© Pharmacotherapy Group, Faculty of Pharmacy, University of Benin, Benin City, 300001 Nigeria.

Available online at http://www.tjpr.org

http://dx.doi.org/10.4314/tjpr.v16i12.13
Original Research Article

Thymol inhibits cell migration and invasion by

downregulating the activation of PI3K/AKT and ERK
pathways in human colon cancer cells
Ran Lv1, Zhenzhou Chen2*
1 2
Gastroenterology Department of Chinese Medicine, China-Japan Friendship Hospital, Beijing 100029, General Surgery
Department, Dongzhimen Hospital of Beijing University of Chinese Medicine, Beijing 100700, China

*For correspondence: Email: [email protected]; Tel: +86-10-84013135

Sent for review: 10 September 2017 Revised accepted: 24 November 2017

Abstract
Purpose: To assess the anti-metastasis effects of thymol on human colorectal cancer cells.
Methods: Human colorectal adenocarcinoma cell HT29 was incubated with varying concentrations of
thymol. Cell viability, migration and invasion were determined by 3-(4, 5-dimethylthiazol-2-yl)-2, 5-
dipheny-tetrazoliumbromide (MTT) and Transwell assays, respectively. Matrix metalloproteinase-2 and -
9 (MMP-2 and MMP-9) were analyzed by gel zymogram assay. Epithelial-mesenchymal transition
(EMT)-associated gene expression and signaling pathway were analyzed using real-time quantitative
polymerase chain reaction (PCR) and Western blotting, respectively.
Results: Thymol was significantly inhibited migration and invasion of HT29 cell (p < 0.01) and also
markedly reduced the activity of matrix degrading enzymes MMP-2 and MMP-9 (p < 0.01). Moreover,
the epithelial marker, E-cadherin, was elevated, while mesenchymal markers (vimentin and α-SMA),
and associated transcription factors (snail and slug) decreased after thymol treatment (p < 0.01). In
addition, thymol inhibited the phosphorylation of PI3K/AKT and ERK pathways (p < 0.01).
Conclusion: Thymol efficiently attenuates cell migration and invasion by decreasing EMT and
downregulating the activation of PI3K/AKT and ERK signaling pathways in colorectal adenocarcinoma
cells. It is, thus, a potential candidate drug for the management of colorectal cancer.

Keywords: Thymol, Colorectal cancer, Anti-metastasis, Epithelial-mesenchymal transition, Vimentin,

PI3K/AKT and ERK pathway

This is an Open Access article that uses a funding model which does not charge readers or their institutions
for access and distributed under the terms of the Creative Commons Attribution License
(http://creativecommons.org/licenses/by/4.0) and the Budapest Open Access Initiative
(http://www.budapestopenaccessinitiative.org/read), which permit unrestricted use, distribution, and
reproduction in any medium, provided the original work is properly credited.

Tropical Journal of Pharmaceutical Research is indexed by Science Citation Index (SciSearch), Scopus,
International Pharmaceutical Abstract, Chemical Abstracts, Embase, Index Copernicus, EBSCO, African
Index Medicus, JournalSeek, Journal Citation Reports/Science Edition, Directory of Open Access Journals
(DOAJ), African Journal Online, Bioline International, Open-J-Gate and Pharmacy Abstracts

INTRODUCTION by year [1]. Modifiable risk factors for CRC

related to lifestyle including smoking, physical
Colorectal cancer (CRC), one kind of the most activity habits, overweight, obesity and alcohol
digestive tract tumors, is the most common consumption. Chemotherapy and surgery are the
reason of cancer-related death, with between most common treatment for CRC. CRC
one and two million new cases diagnosed every treatment has improved due to the application of
year, and its incidence has been increasing year a new generation of chemotherapy and
-----------------------------------------------------------------------------------------------------------------------------------------------------
© 2017 The authors. This work is licensed under the Creative Commons Attribution 4.0 International License
2895
Lv & Chen

molecular-targeted drugs, but it remains Cell viability assay

unsatisfactory. Moreover, the toxic side effects of
chemotherapy drugs and the failure of Cell viability was measured using the colorimetric
chemotherapeutic due to drug resistance are MTT assay as described previously [10,11]. The
some of the drawbacks of clinical treatment [2]. cells were cultured in 96-well plates overnight
The treatment of metastasis is still not and treated with thymol (0.5, 1, 2, 4 mM) for 24
satisfactory, mainly due to lack of effective drugs and 48 h. Thereafter, cell viability was
[3]. Therefore, it is necessary to find new determined by MTT.
effective drugs to fight against metastasis for
CRC. Cell migration assay

Thymol is an active monoterpene isolated from A Transwell assay was employed to determine
many medicinal herbs, such as Thymus vulgaris, cell migration [12]. HT29 cells (1 × 104 cells/well)
Monarda punctate and Origanum vulgare spp [4]. was added into the upper chamber of the
It has been widely used for treatment Transwell plates, and treated with thymol (0.5, 1
inflammatory diseases, such as osteoarthritis [5] and 2 mM), while the lower chamber contained
and asthma [6]. It reported that thymol has 600 μL culture medium with 10 % FBS. After
various bioactivities, such as anticancer [7], anti- treatment for 24 h, the cells that migrated to the
bacterial [8] and antioxidant properties [9]. bottom face of the membranes were stained with
Despite thymol being known for its multifaceted crystal violet solution and further extracted with
activities, the anti-metastatic ability on colorectal 10 % acetic acid. The absorbance at 540 nm
carcinoma cells has not been studied. represents the number of cells that migrated
across the membrane.
The present study was designed to explore the
effect of thymol on metastasis in human Cell invasion assay
colorectal carcinoma cells. In view of its effects
on the phosphorylation of PI3K/AKT and ERK Cell invasive activity was performed by Matrigel
pathways, the underlying mechanisms of how assay [13]. Briefly, 5 × 104 cells were added to
thymol inhibits cell migration and invasion, and the chamber, and 100 μL Matrigel was added to
EMT were explored. the lower chamber. After incubation for 24 h, the
cells were fixed with 4 % formaldehyde, stained
EXPERIMENTAL with crystal violet and further extracted with 10 %
acetic acid. The absorbance at 540 nm
represents the number of cells that invaded
Chemicals and reagents
across the Matrigel.
Thymol (C10H14O, MW: 150.22, purity ≥ 98 %) Gelatin zymography assay
was purchased from Sigma (St. Louis, USA). It
was dissolved in dimethylsulfoxide (DMSO) as The activity of MMP-2 and -9 were analyzed by
stock solution of 10 M, stored at -20 °C, and using the gelatin zymography assay [14]. The
freshly diluted with RPMI-1640 medium (Gibco, HT29 cells were incubated with thymol (0.5, 1
Carlsbad, CA) to the final concentration used in and 2 mM) for 24 h. The supernatants were
the study. [3-(4, 5-dimethylthiazol-2-yl)-2, 5- separated by 10 % SDS-PAGE containing 1 %
dipheny-tetrazoliumbromide] (MTT) was obtained (m/v) gelatin. The gels were visualized after
from Sigma (St. Louis, USA). Antibodies against staining with Coomassie blue and then
the following targets: AKT, phosphor-AKT, ERK, photographed.
phosphor-ERK, and GAPDH were purchased
from Bioworld Technology, Inc. (Louis Park, MN). Western blotting

Cell culture Cell lysates from HT29 cells were extracted in

NP40 lysis buffer, separated by 10 % SDS-
The human colorectal adenocarcinoma HT29 cell PAGE gel and further transferred to PVDF
(American Type Culture Collection, Bethesda, membranes. The membranes were blocked with
MD, USA) were cultured in RPMI1640 medium 5 % nonfat milk for 2 h, and incubated with
(Gibco, Carlsbad, CA, USA) supplemented with specific primary antibodies overnight at 4 °C, and
10 % fetal bovine serum (Gibco, Carlsbad, CA, then incubated with secondary antibody for 1 h at
USA), 100 U/mL penicillin and 100 mg/mL 37 °C. The protein bands were visualized with
streptomycin. Cells were cultured under a ECL reagent (Millipore, Billerica, MA, USA).
humidified 5 % CO2 atmosphere at 37 °C.

2896
Lv & Chen

Quantitative polymerase chain reaction Effect of thymol on MMP-2 and MMP-9

(qPCR) assay activities

Total RNA from HT29 cells was extracted with We evaluated the effects of thymol on
TRIzol according to the kit manufacturer’s extracellular matrix degradation catalyzed by
instructions. RNA was transcribed to CDNA, MMPs with gelatin zymography assay. Figure 4
which were analyzed for the expression of E- showed that thymol (0.5, 1 and 2 mM) decreased
cadherin, Vimentin, α-SMA, Snail and Slug by IQ the activity of MMP-2 and MMP-9 in a
SYBRGreen Supermix (Bio-Rad, Hercules, CA, concentration-dependent manner.
USA). Primers were obtained from Sangon
Biotech (Shanghai, China) and the details of the
primers were listed in Table 1.

Statistical analysis

The data are given as mean ± SEM (n = 3).

Differences between the groups were analyzed
using SPSS software and one-way analysis of
variance (ANOVA) followed by Dunnett's test. P
< 0.05 was considered statistically significant.

RESULTS
Effect of thymol on viability in HT29 cells

Firstly, we investigated the effect of thymol on

cell viability at different concentrations (0.5, 1, 2 Figure 1: Effect of thymol on the cell viability in HT29
and 4 mM). As shown in Figure 1, after treatment cells. HT29 cells were incubated with thymol (0.5, 1, 2,
and 4 mM) for 24 and 48 h, and cell viability was
for 24 and 48 h, thymol markedly (4 mM)
examined by MTT assay. Data are expressed as
inhibited the cell viability in HT29 cells. mean ± SEM (n = 3); *p < 0.05, **: p < 0.01 vs control
Therefore, further studies were conducted using
thymol (0.5, 1 and 2 mM) to avoid its cytotoxicity.

Effect of thymol on cell migration

To evaluate the anti-metastatic effect of thymol

on HT29 cells, the migration of HT29 cells by
Transwell assay was performed. As shown in
Figure 2, thymol (1 and 2 mM) treatment led to
an obvious decrease in HT29 cell migration
across the membrane, compared to the control
group.

Effect of thymol on cell invasion

Figure 2: Effect of thymol on cell migration. HT29 cells
HT29 cells were added into the upper chamber were incubated with thymol (0.5, 1 and 2 mM) for 24 h,
of Transwell insert pre-coated with Matrigel. After and cell migration was analyzed by Transwell assay.
treatment with thymol (0.5, 1 and 2 mM) for 24 h, Migrated cells were stained with Crystal violet and the
there was a concentration-dependent decrease numbers of migrated cells were determined by
on the invasion of HT29 cells, compared to the absorbance at 540 nm. Data are expressed as mean ±
control (Figure 3). SEM (n = 3); *p < 0.05, **p < 0.01 vs control

Table 1: Primer sequences ofβ-actin

mouse used in CCAACCGCGAGAAGATGA TCCATCACGATGCCAGTG
real-time PCR

arget gene Forward primer 5’-3’ Reverse primer 5’-3’

-cadherin GAGCCTGAGTCCTGCAGTCC GTATTGCTGCTTGGCCTCA
imentin AAAGTGTGGCTGCCAAGAAC AGCCTCAGAGAGGTCAGCAA
-SMA GGGTACCACCATGTACCCA CACAGTTGTGTGCTAGAGGC
nail CCCCAATCGGAAGCCTAACT CGTAGGGCTGCTGGAAGGTA
lug CCATTCCACGCCCAGCTA CTCACTCGCCCCAAAGATGA

2897
Lv & Chen

certain markers, including p-AKT and p-ERK.

The results showed that thymol markedly
decreased the phosphorylation levels of AKT and
ERK, while it had no significant effect on the total
levels of AKT and ERK in a concentration-
dependent manner (Figure 6).

Figure 3: Effect of thymol on cell invasion. HT29 cells

were treated with thymol (0.5, 1 and 2 mM) for 24 h,
and cell invasion was detected by Transwell assay.
Invaded cells were stained with Crystal violet and the
numbers of invaded cells were obtained by
absorbance at 540 nm. Data are expressed as mean ±
SEM (n = 3); *p < 0.05, **: p < 0.01 vs control
Figure 5: Effect of thymol on the mRNA expression of
EMT-associated genes. HT29 cells were treated with
thymol (0.5, 1 and 2 mM) for 24 h. Total RNA were
extracted and the mRNA expression of E-cadherin,
Vimentin, α-SMA, Snail and Slug were measured by
real-time PCR assay. Gene expressions were
normalized to β-actin. Data were expressed as means
± SEM of three independent experiments *: P < 0.05,
**: P < 0.01 vs control

DISCUSSION
Metastasis is one of the major reasons of high
mortality in CRC patients [15]. EMT, a process
that tumor cell migrated and invaded from the
surrounding tissue to the circulation, is
Figure 4: Effect of thymol on MMP-2 and MMP-9
characterized as the early step of the metastatic
activities. HT29 cells were treated with thymol (0.5, 1 process [16]. Therefore, a compound that can
and 2 mM) for 24 h. MMP-2 and MMP-9 on the effectively restrain cancer cell migration and
degradation of gelatin were assessed. Data are invasion has the potential to be developed as a
expressed as mean ± SEM (n = 3); *p < 0.05, **: p < candidate drug for preventing or treating
0.01 vs control metastatic cancers. In this study, thymol
significantly inhibited the migration and invasion
Effect of thymol on epithelial-mesenchymal in HT29 cells. It decreased the activity of MMP-2
transition (EMT) and MMP-9. The mechanisms may involve the
inhibition of EMT and downregulation of the
Whether thymol plays important roles in EMT of activation of PI3K/AKT and ERK signaling
colon cancer cells HT29, we analyzed the mRNA pathways.
expression of major EMT biomarkers, including
E-cadherin, Vimentin, α-SMA, Snail and Slug by Invasion and migration have been acknowledged
using real-time PCR. As shown in Figure 5, as the most lethal attributes of solid tumors and
thymol (2 mM) markedly increased the mRNA account for the majority of metastases [17].
expression of E-cadherin, while decreased the Tumor cells have the ability to migrate from the
mRNA expression of α-SMA, Vimentin, Snail and original site to the blood and lymph, and invade
Slug. surrounding or distant tissues, causing
metastasis. Our results from the present study
Effect of thymol on the PI3K/AKT and ERK showed that thymol could suppress migration
pathway and invasion in HT29 cells.

To find out whether the effect of thymol on HT-29 MMPs, a group of zinc-dependent
cell invasion and migration involves PI3K/AKT or endopeptidases, are important mediators of
MAPK/ERK pathway, Western blot was invasion and degradation of basement
performed to evaluate the protein levels of membranes and extracellular matrix [18]. MMP-2

2898
Lv & Chen

Figure 6: Effect of thymol on the activation of PI3K/AKT and ERK pathways. HT29 cells were treated with thymol
(0.5, 1 and 2 mM) for 24 h. (A) Cells were harvested and lysed, and the levels of p-AKT, AKT, p-ERK, ERK and
GAPDH were assessed by Western blot. (B) Densitometry analysis of immunoblotting was also shown. Data
were presented as means ± SEM of three independent experiments *: P < 0.05, **: P < 0.01 vs control

and MMP-9 abundantly expressed in various PI3K/AKT pathway overactivation is frequently

cancers, are considered to play key roles in present in CRC and is associated with tumor
tumor invasion and metastasis [19]. In addition, progression processes, including cell
mounting evidence suggests that inhibition of proliferation, migration and invasion [25]. It has
MMP-9 and MMP-2 by chemopreventive agents been shown to contribute to tumor metastasis by
suppresses the invasiveness and metastases of promoting the secretion of MMPs and the
many cancer cells [20,21]. In the present study, induction of EMT [26]. It reported that MAPKs,
thymol (1 and 2 mM) markedly reduced the such as ERK seem to play a central role in
activity of MMP-2 and MMP-9 in HT29 cells. regulating the expression of MMPs, inhibition of
the MAPK pathway might also potentially prevent
Numerous studies have reported the correlation invasion and metastasis of a variety of tumors
between EMT and cancer progression and [27]. The Western blotting results suggested that
metastasis [22]. Epithelial-derived tumor cells thymol could significantly inhibit the activation of
become malignant and obtain an invasive AKT and ERK in HT29 cells.
phenotype is mainly through an EMT process
[23]. Several molecular markers, the down- CONCLUSION
regulation of epithelial cell surface marker E-
cadherin, the up-regulation of mesenchymal This study has demonstrated that thymol is able
markers vimentin and α-SMA, and the EMT- to inhibit the migration and invasion of HT29
inducing transcription factors such as Snail and human colon cancers, and reduce the activity of
Slug, are the representative phenotypes of EMT MMP-2 and MMP-9. The mechanisms may
[24]. Our results revealed that thymol inhibited involve the inhibition of EMT and downregulation
EMT, evidenced by increasing expression of E- of the activation of PI3K/AKT and ERK signaling
cadherin, decreasing the expression of vimentin pathways. These results provided new insights
and α-SMA, and associated transcription factors into the anti-cancer mechanisms of thymol, which
Snail and Slug. may be helpful in the development of thymol into
a promising therapeutic agent against colorectal
carcinoma.

2899
Lv & Chen

pump inhibitors of thymol and carvacrol against food-

DECLARATIONS borne pathogens. Microb Pathog 2016; 99: 95-100.
9. Fitsiou E, Anestopoulos I, Chlichlia K, Galanis A,
Conflicts of interest Kourkoutas I, Panayiotidis MI, Pappa A. Antioxidant and
Antiproliferative Properties of the Essential Oils of
No conflict of interest is associated with this Satureja thymbra and Satureja parnassica and their
work. Major Constituents. Anticancer Res 2016; 36: 5757-
5763.
Contribution of authors 10. Zhao P, Chen L, Li LH, Wei ZF, Tong B, Jia YG, Kong
LY, Xia YF, Dai Y. SC-III3, a novel scopoletin derivative,
We declare that this work was done by the induces cytotoxicity in hepatocellular cancer cells
authors named in this article and all liabilities through oxidative DNA damage and ataxia
pertaining to claims relating to the content of this telangiectasia-mutated nuclear protein kinase activation.
article will be borne by the authors. BMC Cancer 2014; 14: 987.
11. Sun Y, Zhao Y, Wang X, Zhao L, Li W, Ding Y, Kong L,
Ran Lv and Zhenzhou Chen conceived and Guo Q, Lu N. Wogonoside prevents colitis-associated
designed the study; collected and analyzed the colorectal carcinogenesis and colon cancer progression
data; and wrote the manuscript. Both authors in inflammation-related microenvironment via inhibiting
have read the manuscript and approved for NF-kappaB activation through PI3K/Akt pathway.
publication. Oncotarget 2016; 7: 34300-34315.
12. Wang Y, Xu X, Zhao P, Tong B, Wei Z, Dai Y. Escin Ia
REFERENCES suppresses the metastasis of triple-negative breast
cancer by inhibiting epithelial-mesenchymal transition
1. Marmol I, Sanchez-de-Diego C, Pradilla Dieste A, via down-regulating LOXL2 expression. Oncotarget
Cerrada E, Rodriguez Yoldi MJ. Colorectal Carcinoma: 2016; 7: 23684-23699.
A General Overview and Future Perspectives in 13. Zhou Q, Chen J, Feng J, Xu Y, Zheng W, Wang J.
Colorectal Cancer. Int J Mol Sci 2017; 18: 197. SOSTDC1 inhibits follicular thyroid cancer cell
2. Peeters M, Oliner KS, Price TJ, Cervantes A, Sobrero proliferation, migration, and EMT via suppressing
AF, Ducreux M, Hotko Y, Andre T, Chan E, Lordick F, et PI3K/Akt and MAPK/Erk signaling pathways. Mol Cell
al. Analysis of KRAS/NRAS Mutations in a Phase III Biochem 2017.
Study of Panitumumab with FOLFIRI Compared with 14. Lv Q, Zhu X-Y, Xia Y-F, Dai Y, Wei Z-F. Tetrandrine
FOLFIRI Alone as Second-line Treatment for Metastatic inhibits migration and invasion of rheumatoid arthritis
Colorectal Cancer. Clin Cancer Res 2015; 21: 5469- fibroblast-like synoviocytes through down-regulating the
5479. expressions of Rac1, Cdc42, and RhoA GTPases and
3. Xu Y, Xu G, Liu L, Xu D, Liu J. Anti-invasion effect of activation of the PI3K/Akt and JNK signaling pathways.
rosmarinic acid via the extracellular signal-regulated Chinese Journal of Natural Medicines 2015; 13: 831-
kinase and oxidation-reduction pathway in Ls174-T 841.
cells. J Cell Biochem 2010; 111: 370-379. 15. Mlecnik B, Bindea G, Kirilovsky A, Angell HK, Obenauf
4. Saravanan S, Pari L. Protective effect of thymol on high AC, Tosolini M, Church SE, Maby P, Vasaturo A,
fat diet induced diabetic nephropathy in C57BL/6J mice. Angelova M, et al. The tumor microenvironment and
Chem Biol Interact 2016; 245: 1-11. Immunoscore are critical determinants of dissemination
5. Patil D, Dhaneshwar S, Kadam P. Diacerein-thymol to distant metastasis. Sci Transl Med 2016; 8: 327-326.
prodrug: in vivo release and pharmacological screening 16. Lee JM, Dedhar S, Kalluri R, Thompson EW. The
in experimental models of osteoarthritis in Wistar rats. epithelial-mesenchymal transition: new insights in
Inflamm Allergy Drug Targets 2015; 13: 393-405. signaling, development, and disease. J Cell Biol 2006;
6. Zhou E, Fu Y, Wei Z, Yu Y, Zhang X, Yang Z. Thymol 172: 973-981.
attenuates allergic airway inflammation in ovalbumin 17. Zhao Q, Xu L, Sun X, Zhang K, Shen H, Tian Y, Sun F, Li
(OVA)-induced mouse asthma. Fitoterapia 2014; 96: Y. MFG-E8 overexpression promotes colorectal cancer
131-137. progression via AKT/MMPs signalling. Tumour Biol
7. Pathania AS, Guru SK, Verma MK, Sharma C, Abdullah 2017; 39: 1010428317707881.
ST, Malik F, Chandra S, Katoch M, Bhushan S. 18. Sternlicht MD, Werb Z. How matrix metalloproteinases
Disruption of the PI3K/AKT/mTOR signaling cascade regulate cell behavior. Annu Rev Cell Dev Biol 2001; 17:
and induction of apoptosis in HL-60 cells by an essential 463-516.
oil from Monarda citriodora. Food Chem Toxicol 2013; 19. Thiyagarajan V, Lin SH, Chia YC, Weng CF. A novel
62: 246-254. inhibitor, 16-hydroxy-cleroda-3,13-dien-16,15-olide,
8. Miladi H, Zmantar T, Chaabouni Y, Fedhila K, Bakhrouf blocks the autophosphorylation site of focal adhesion
A, Mahdouani K, Chaieb K. Antibacterial and efflux kinase (Y397) by molecular docking. Biochim Biophys
Acta 2013; 1830: 4091-4101.

2900
Lv & Chen

20. Thiyagarajan V, Tsai MJ, Weng CF. Antroquinonol 24. Ahn HM, Yoo JW, Lee S, Lee HJ, Lee HS, Lee DS.
Targets FAK-Signaling Pathway Suppressed Cell Peroxiredoxin 5 promotes the epithelial-mesenchymal
Migration, Invasion, and Tumor Growth of C6 Glioma. transition in colon cancer. Biochem Biophys Res
PLoS One 2015; 10: e0141285. Commun 2017; 487: 580-586.
21. Zhao HJ, Liu T, Mao X, Han SX, Liang RX, Hui LQ, Cao 25. Khan MW, Keshavarzian A, Gounaris E, Melson JE,
CY, You Y, Zhang LZ. Fructus phyllanthi tannin fraction Cheon EC, Blatner NR, Chen ZE, Tsai FN, Lee G, Ryu
induces apoptosis and inhibits migration and invasion of H, et al. PI3K/AKT signaling is essential for
human lung squamous carcinoma cells in vitro via communication between tissue-infiltrating mast cells,
MAPK/MMP pathways. Acta Pharmacol Sin 2015; 36: macrophages, and epithelial cells in colitis-induced
758-768. cancer. Clin Cancer Res 2013; 19: 2342-2354.
22. Iwatsuki M, Mimori K, Yokobori T, Ishi H, Beppu T, 26. Faes S, Dormond O. PI3K and AKT: Unfaithful Partners
Nakamori S, Baba H, Mori M. Epithelial-mesenchymal in Cancer. Int J Mol Sci 2015; 16: 21138-21152.
transition in cancer development and its clinical 27. Yang HL, Kuo YH, Tsai CT, Huang YT, Chen SC, Chang
significance. Cancer Sci 2010; 101: 293-299. HW, Lin E, Lin WH, Hseu YC. Anti-metastatic activities
23. Yang J, Weinberg RA. Epithelial-mesenchymal transition: of Antrodia camphorata against human breast cancer
at the crossroads of development and tumor metastasis. cells mediated through suppression of the MAPK
Dev Cell 2008; 14: 818-829. signaling pathway. Food Chem Toxicol 2011; 49: 290-
298.

2901