Fundamentals of life sciences

303 ‫ح‬

3 rd year of Biophysics
Part of Cytology
By
Dr. Omar Elmenshawy
Cytology
Definition of Cytology
A branch of biology dealing with the structure, function,
multiplication, pathology, and life history of cells .
To define cytology, we can break down the word into two parts.
The suffix -logy, or -ology means the 'study of.’
To find out what we're studying, we look to the prefix cyto, which
means 'cell' and is derived from the Greek word kytos, meaning
'hollow vessel' or 'container.’
Put these two together, and we have our definition: cytology is the
study of cells.
More specifically, cytology is a branch of science that studies how
cells work and grow and what they're made of.
Discovery of Cells
• Early History
The history of cell science is closely linked with the invention
and advancement of the microscope.
Robert Hooke was the first scientist to use the word 'cell' in
1665 when he looked at slices of cork through a lit compound
microscope (a microscope with two or more lenses) and
observed very small, irregular boxes that reminded him of tiny
rooms, or cells.
Hooke wrote about his findings and drew the structures he
saw in his book Micrographia, which was published in 1665.
Cell theory
• The importance of cells to all forms of life was not fully recognized until the
development of cell theory.
• The earliest (classical) cell theory was developed in the 1838 by plant
scientist Matthias Schleiden and animal scientist Theodor Schwann. They each
came to the same conclusion that the living things they studied were composed of
cells.
• The classical cell theory summarized the ideas of the previously mentioned scientists
into the following points:
• All organisms are made up of one or more cells
• Cells are the fundamental functional and structural units of life
• In 1858, Rudolf Virchow added to the classical cell theory with the idea that:
• Cells only come from other cells
Principles of Cell Theory
• The three tenets to the cell theory are as described below:
1.All living organisms are composed of one or more cells.
2.The cell is the basic unit of structure and organization in
organisms.
3.Cells arise from pre-existing cells.
Characteristics of All Cells

• All cells share four common components:

• a plasma membrane: an outer covering that separates the
cell's interior from its surrounding environment.
• cytoplasm: a jelly-like cytosol within the cell in which other
cellular components are found.
• DNA: the genetic material of the cell.
• Organelles : structures for cell function
Cell Types

• Prokaryotic

• Eukaryotic
Prokaryotic Cells
Prokaryotes are unicellular organisms that lack organelles or
other internal membrane-bound structures.
Therefore, they do not have a nucleus, but, instead, generally
have a single chromosome: a piece of circular, double-stranded
DNA located in an area
of the cell called
the nucleoid.
Prokaryotic Cells
• First cell type on earth
• Cell type of Bacteria and Archaea (another
term for archaebacteria).
Prokaryotic Cells
• No membrane bound nucleus
• Nucleoid = region of DNA concentration
• Organelles not bound by membranes
Eukaryotic Cells
Eukaryotic cells are cells that contain a nucleus and organelles,
and are enclosed by a plasma membrane. Organisms that
have eukaryotic cells include protozoa, fungi, plants and
animals.
These organisms are grouped into the biological domain
Eukaryota.
Eukaryotic Cells
Characteristics of Eukaryotic Cells
Eukaryotic cells contain a variety of structures called organelles,
which perform various functions within the cell. Examples of
organelles are ribosomes, which make proteins, the endoplasmic
reticulum, which sorts and packages the proteins,
and mitochondria, which produce the energy molecule adenosine
triphosphate (ATP).
They also have a true nucleus, which contains the genetic
material DNA and is surrounded by a nuclear envelope.
Eukaryotic Cells
All of the organelles are stabilized and given physical support
through the cytoskeleton, which is also involved in sending
signals from one part of the cell to the other.
In eukaryotic cells, the cytoskeleton is composed mainly of three
types of filaments: microtubules, microfilaments, and
intermediate filaments.
The gel-like substance that surrounds all the organelles in the cell
is called cytosol.
Eukaryotic Cells
• Nucleus bound by membrane
• Include fungi, protists, plant, and
animal cells
• Possess many organelles

Protozoan
Representative Animal Cell
Plasma Membrane
Fluid mosaic model
• Why is plasma membrane called fluid mosaic model?
It is sometimes referred to as a fluid mosaic because it has
many types of molecules which float along the lipids due to the
many types of molecules that make up the cell membrane. ...
The liquid part is the lipid bilayer which floats along the lipids
due to the many types of molecules that make up the cell.
Plasma Membrane
Fluid mosaic model
• Contains cell contents
• Double layer of phospholipids & proteins
Plasma Membrane
Fluid mosaic model
What are the 4 components of the plasma membrane?
The principal components of the plasma membrane
are lipids ( phospholipids and cholesterol), proteins, and
carbohydrates.
Plasma Membrane
Fluid mosaic model
Phospholipids
When phospholipids are mixed with water, they spontaneously
rearrange themselves to form the lowest free-energy
configuration.
This means that the hydrophobic (‫ ) كاره للماء‬regions find ways to
remove themselves from water, while the hydrophilic ( ‫) محب للماء‬
regions interact with water.
The resulting structure is called a lipid bilayer.
Phospholipids

• Polar hydrophilic head

• Non-polar hydrophobic
tail
Membrane Proteins
plasma membrane proteins carry out functions as diverse as
ferrying nutrients across the plasma membrane, receiving
chemical signals from outside the cell, translating chemical
signals into intracellular action, and sometimes anchoring
the cell in a particular location
Membrane Proteins
1. Channels or transporters
• Move molecules in one direction
2. Receptors
• Recognize certain chemicals
Membrane Proteins
3. Glycoproteins
• Identify cell type
4. Enzymes
• Catalyze production of substances
Movement across the
Cell Membrane
Getting through cell membrane
All cells are enclosed by a cell membrane, which is selectively permeable.
Molecules can move into or out of cells by diffusion and active transport. Cells
can gain or lose water by osmosis.
Passive Transport
• Simple diffusion
• diffusion of nonpolar, hydrophobic molecules
• lipids
• high → low concentration gradient
• Facilitated transport
• diffusion of polar, hydrophilic molecules
• through a protein channel
• high → low concentration gradient
• Active transport
• diffusion against concentration gradient
• low → high ATP
• uses a protein pump
• requires ATP
Transport summary
simple
diffusion

facilitated
diffusion

active ATP

transport
How about large molecules?
• Moving large molecules into & out of cell
• through vesicles & vacuoles
• endocytosis
• phagocytosis = “cellular eating”
• pinocytosis = “cellular drinking”
• exocytosis

exocytosis
Endocytosis
fuse with lysosome
phagocytosis
for digestion

pinocytosis non-specific
process

receptor-mediated triggered by
endocytosis molecular signal
Osmosis is diffusion of water
• Water is very important to life,
so we talk about water separately
• Diffusion of water from
high concentration of water to
low concentration of water
• across a
semi-permeable
membrane
Concentration of water
• Direction of osmosis is determined by comparing
total solute concentrations
• Hypertonic - more solute, less water
• Hypotonic - less solute, more water
• Isotonic - equal solute, equal water

water

hypotonic hypertonic
net movement of water
Managing water balance
• Cell survival depends on balancing water uptake &
loss

freshwater balanced saltwater

Cytoplasm
• The cytoplasm provides a medium for the organelles to remain
suspended.
• The cytoplasm acts as a buffer and protects the genetic
material of the cell and also the cellular organelles from
damage caused due to movement and collision( ‫ ) تصادم‬with
other cells.
• Cellular respiration begins in the cytoplasm with glycolysis.
Cytoplasm
• Viscous fluid containing organelles components of
cytoplasm
• Interconnected filaments & fibers
• Fluid = cytosol
• Organelles (not nucleus)
• storage substances
Organelles
Organelles are considered either membranous or non-membranous.
Membranous organelles possess their own plasma membrane to create
a lumen separate from the cytoplasm.
This may be the location of hormone synthesis or degradation of
macromolecules.
Non-membranous organelles are not surrounded by a plasma
membrane.
Most non-membranous organelles are part of the cytoskeleton, the
major support structure of the cell.
These include: filaments, microtubules, and centrioles.
Membranous Organelles
• Functional components within cytoplasm
• Bound by membranes
Nucleus
The nucleus is a membrane-bound organelle that contains
genetic material (DNA) of eukaryotic organisms.
As such, it serves to maintain the integrity of the cell by
facilitating transcription and replication processes.
It's the largest organelle inside the cell taking up about a tenth of
the entire cell volume.
Function of the nucleus :
The nucleus has very important roles to play.
As it contains genetic material, it coordinates cell activities like
protein synthesis and cell division.
Nucleus
The nuclear membrane :
The nucleus contains and confines the genetic material of a
eukaryotic cell.
Prokaryotic cells do not have a defined nucleus, but rather have
genetic material within the cytoplasm.
The nuclear envelope is the cellular component that surrounds
and defines the nucleus.
Nucleus
What is the role of the neuclear membrane ?
A nuclear membrane is a double membrane that encloses the cell nucleus.
It serves to separate the chromosomes from the rest of the cell.
The nuclear membrane includes an array of small holes or pores ( ‫مجموعة‬
‫ )من الثقوب الصغيرة‬that permit the passage of certain materials, such as nucleic
acids and proteins, between the nucleus and cytoplasm.
Nucleus
What is the differences between cell membrane and nuclear
membrane ?
The cell membrane is the lipid bilayer surrounding the entire cell.
The nuclear membrane, on the other hand, surrounds the nucleus.
The cell membrane is in the form of a continuous sheet.
The nuclear envelope is composed of two concentric lipid bilayer membranes separated
by an intermembrane space of about 20-40 nm.
The outer membrane is continuous in many places with the rough endoplasmic reticulum.
Like the rough ER the outer membrane of the nuclear envelope is dotted with ribosomes.
Nucleus

• Control center of cell

• Double membrane

• Contains
• Chromosomes
• Nucleolus
Nuclear Envelope
• Separates nucleus from rest of cell

• Double membrane

• Has pores
DNA , Deoxyribonucleic Acid
DNA , deoxyribonucleic acid, is the molecule that contains the
genetic code of organisms.
This includes animals, plants, protists, archaea and bacteria.
DNA is in each cell in the organism and tells cells what proteins
to make.
DNA , Deoxyribonucleic Acid
What is DNA made ?
DNA is made of chemical building blocks called nucleotides.
These building blocks are made of three parts:
a phosphate group, a sugar group and one of four types of
nitrogen bases.
To form a strand of DNA, nucleotides are linked into chains, with
the phosphate and sugar groups alternating.
DNA , Deoxyribonucleic Acid
DNA
RNA
DNA , Deoxyribonucleic Acid
What is the function of DNA ?
The main role of DNA in the cell is the long term storage of
information.
It is often compared to a blueprint, since it contains the
instructions to construct other components of the cell, such
as proteins and RNA molecules.
DNA

• Hereditary material

• Chromosomes
• DNA
• Protiens
• Form for cell division
• Chromatin
Nucleolus
The nucleolus is the distinct structure present in the nucleus of
eukaryotic cells.
Primarily, it participates in assembling the ribosomes, alteration of
transfer RNA and sensing cellular stress. The nucleolus is
composed of RNA and proteins, which form around specific
chromosomal regions.
Nucleolus
• Most cells have 2 or more
• Directs synthesis of RNA
• Forms ribosomes
Endoplasmic Reticulum
• Helps move substances within cells

• Network of interconnected membranes

• Two types
• Rough endoplasmic reticulum
• Smooth endoplasmic reticulum
Endoplasmic Reticulum
Endoplasmic reticulum (ER), in biology, a continuous membrane
system that forms a series of flattened sacs within the cytoplasm
of eukaryotic cells and serves multiple functions, being important
particularly in the synthesis, folding, modification, and transport
of proteins
In muscles the smooth ER assists in the contraction of muscle
cells, and in brain cells it synthesizes male and female hormones.
What does the rough endoplasmic
reticulum produce?
The rough endoplasmic reticulum manufactures membranes and
secretory proteins.
The ribosome sattached to the rough ER synthesize proteins by
the process of translation.
In certain leukocytes(white blood cells), the rough ER produces
antibodies.
In pancreatic cells, the rough ER produces insulin.
Endoplasmic Reticulum
What type of cell has smooth endoplasmic reticulum?
The rough endoplasmic reticulum is especially prominent in cells such
as hepatocytes.
The smooth endoplasmic reticulum lacks ribosomes and functions in
lipid synthesis but not metabolism, the production of steroid hormones,
and detoxification.
The smooth ER is especially abundant in mammalian liver and gonad
cells.
Rough Endoplasmic Reticulum
• Ribosomes attached to surface
• Manufacture proteins
• Not all ribosomes attached to rough ER
Smooth Endoplasmic Reticulum
• No attached ribosomes
• Has enzymes that help build molecules
• Carbohydrates
• Lipids
• Plays role in detoxification (in liver cells)
• Store calcium in skeletal muscles
Golgi Apparatus
Golgi apparatus, also called Golgi complex or Golgi body,
membrane-bound organelle of eukaryotic cells (cells with clearly
defined nuclei) that is made up of a series of flattened, stacked
pouches called cisternae.
The Golgi apparatus is responsible for transporting, modifying,
and packaging proteins and lipids into vesicles for delivery to
targeted destinations.
It is located in the cytoplasm next to the endoplasmic
reticulum and near the cell nucleus.
While many types of cells contain only one or several Golgi
apparatus, plant cells can contain hundreds.
Golgi Apparatus
Golgi Apparatus
While many types of cells contain only one or several Golgi
apparatus, plant cells can contain hundreds.
The Golgi apparatus is responsible for transporting, modifying,
and packaging proteins and lipids into vesicles for delivery to
targeted destinations.
Golgi Apparatus
 Packaging and shipping station of cell(‫)محطة تعبئة وشحن للخلية‬
 Involved in synthesis of glycoproteins (cell membrane)
 Abundant in secretory cells (like pancreas)
 Forms acrosome in sperms
 Plays role in formation of lysosomes
Golgi Apparatus
(Protein Trafficking)
1. Protein molecules come in transfer vesicles
from rough endoplasmic reticulum

2. Vesicles fuse with Golgi membrane

3. Molecules may be modified by Golgi (addition

of carbohydrates)
Golgi Apparatus
(Protein Trafficking) (Continued)
4. Molecules pinched-off ( ‫ ) تنفصل‬in separate vesicle
(secretory vesicles)

5. Vesicle leaves Golgi apparatus

6. Vesicles may combine with plasma membrane to

secrete contents
Lysosome
Lysosome, subcellular ( ‫ ) فرعي خلوي‬organelle that is found in
nearly all types of eukaryotic cells (cells with a clearly defined
nucleus) and that is responsible for the digestion of
macromolecules, old cell parts, and microorganisms.
Each lysosome is surrounded by a membrane that maintains an
acidic environment within the interior via a proton pump.
Lysosomes contain a wide variety of hydrolytic enzymes (acid
hydrolases) that break down macromolecules such as nucleic
acids, proteins, and polysaccharides.
Lysosome
These enzymes are active only in the lysosome’s acidic interior;
their acid-dependent activity protects the cell from self-
degradation in case of lysosomal leakage or rupture, since the pH
of the cell is neutral to slightly alkaline.
Lysosomes were discovered by the Belgian cytologist Christian
René de Duve in the 1950s. (De Duve was awarded a share of the
1974 Nobel Prize for Physiology or Medicine for his discovery of
lysosomes and other organelles known as peroxisomes.)
Lysosomes
• Contain digestive enzymes (acid hydrolyases)
• Functions
• Aid in cell renewal
• Break down old cell parts
• Digests invaders
Lysosomes

Q ui ck Tim e™ a nd a
TIFF (Un co mp res se d ) de co mp res so r
a re n ee de d to se e th i s p ic ture .
Mitochondria
Mitochondrion, membrane-bound organelle found in
the cytoplasm of almost all eukaryotic cells (cells with clearly
defined nuclei), the primary function of which is to generate large
quantities of energy in the form of adenosine triphosphate (ATP).
Mitochondria are typically round to oval in shape and range in
size from 0.5 to 10 μm.
In addition to producing energy, mitochondria
store calcium for cell signaling activities, generate heat, and
mediate cell growth and death.
Mitochondria
The number of mitochondria per cell varies widely; for example, in
humans, erythrocytes (red blood cells) do not contain any
mitochondria, whereas liver cells and muscle cells may contain
hundreds or even thousands.
The only eukaryotic organism known to lack mitochondria is the
oxymonad Monocercomonoides species.
Mitochondria are unlike other cellular organelles in that they have two
distinct membranes and a unique genome and reproduce by binary
fission; these features indicate that mitochondria share an
evolutionary past with prokaryotes (single-celled organisms).
Mitochondria
• Have their own DNA
• Bound by double membrane
Mitochondria
• Break down fuel molecules (during cellular respiration)
• Glucose
• Fatty acids

• Release energy (ATP)

The Cytoskeleton
• Maintains cell shape

• Assists in movement of cell and organelles

• Three types of macromolecular fibers

• Actin Filaments

• Intermediate Filaments

• Microtubules

• Assemble and disassemble as needed

The Cytoskeleton:
Actin Filaments
• Extremely thin filaments like twisted pearl necklace
• Dense web just under plasma membrane maintains cell shape
• Support for microvilli in intestinal cells
• Intracellular traffic control
• For moving stuff around within cell
• Cytoplasmic streaming
• Function in pseudopods of amoeboid cells
• Pinch mother cell in two after animal mitosis
• Important component in muscle contraction (other is myosin)
The Cytoskeleton:
Actin Filament
Operation
The Cytoskeleton:
Intermediate Filaments
• Intermediate in size between actin filaments and microtubules
• Rope-like assembly of fibrous polypeptides
• Vary in nature
• From tissue to tissue
• From time to time
• Functions:
• Support nuclear envelope
• Cell-cell junctions, like those holding skin cells tightly together
The Cytoskeleton:
Microtubules
• Hollow cylinders made of two globular proteins called a and b tubulin
• Spontaneous pairing of a and b tubulin molecules form structures
called dimers
• Dimers then arrange themselves into tubular spirals of 13 dimers
around
• Assembly:
• Under control of Microtubule Organizing Center (MTOC)
• Most important MTOC is centrosome
• Interacts with proteins kinesin and dynein to cause movement of
organelles
The Cytoskeleton:
Microtubule Operation
Microtubular Arrays:
Centrioles
• Short, hollow cylinders
• Composed of 27 microtubules
• Microtubules arranged into 9 overlapping triplets
• One pair per animal cell
• Located in centrosome of animal cells
• Oriented at right angles to each other
• Separate during mitosis and form spindle fibers
• May give rise to basal bodies of cilia and flagella
Cytoskeleton:
Centerioles
Microtubular arrays:
Cilia and Flagella
• Hair-like projections from cell surface that aid in cell movement
• Very different from prokaryote flagella
• Outer covering of plasma membrane
• Inside this is a cylinder of 18 microtubules arranged in 9 pairs
• In center are two single microtubules
• This 9 + 2 pattern used by all cilia & flagella
• In eukaryotes, cilia are much shorter than flagella
• Cilia move in coordinated waves like oars
• Flagella move like a propeller or cork screw
Structure of a Flagellum
Mitosis and Meiosis
Mitosis and Meiosis
Organisms grow and reproduce through cell division.
In eukaryotic cells, the production of new cells occurs as a result
of mitosis and meiosis.
These two nuclear division processes are similar but distinct.
Both processes involve the division of a diploid cell, or a cell
containing two sets of chromosomes (one chromosome donated
from each parent).
Mitosis and Meiosis
What is the concept of mitosis and meiosis?
Mitosis and meiosis are nuclear division processes that occur
during cell division.
Mitosis involves the division of body cells, while meiosis involves
the division of sex cells.
The division of a cell occurs once in mitosis but twice in meiosis.
Mitosis
In mitosis, the genetic material (DNA) in a cell is duplicated and
divided equally between two cells.
The dividing cell goes through an ordered series of events called
the cell cycle.
The mitotic cell cycle is initiated by the presence of certain growth
factors or other signals that indicate that the production of new
cells is needed.
Mitosis
Somatic cells of the body replicate by mitosis.
Examples of somatic cells include fat cells, blood cells, skin cells,
or any body cell that is not a sex cell.
Mitosis is necessary to replace dead cells, damaged cells, or cells
that have short life spans.
Cell cycle and mitosis
• Mitosis consists of ~10-20% of cell cycle, depending on cell type
• Interphase refers to remainder of cell cycle
• Three phases: G1, S, G2
• Mitosis often referred to as “M” phase
• DNA is duplicated during S phase in preparation for next mitotic
division
Mitosis: MITOSIS ME
•An important part of the cell
Parent cell Chiasma
cycle Chromosome Chromosome
• A process of nuclear Prophase replication replication

division in eukaryotic cells

2n = 6
•It is divided into five stages Replicated chromosome

(prophase, metaphase,
anaphase, and telophase Metaphase

•Conserves chromosome
number
•Generates somatic cells in Anaphase
Telophase
multi-cellular organisms
(growth, repair) Daug
cells
meios
2n 2n
Daughter cells n n
of mitosis Daughter cells
Meiosis
Reduction Division
‫الانقسام الاختزالي هو نوع من الانقسام‬
Meiosis ‫الخلوي في الكائنات الحية التي تتكاثر‬
‫جنسيًا والذي يقلل من عدد الكروموسومات في‬
Meiosis is a type of cell division in sexually‫البويضة‬
reproducing
‫الأمشاج (الخلايا الجنسية أو‬
organisms that reduces the number of chromosomes
‫)والحيوانات المنوية‬. in
gametes (the sex cells, or egg and sperm).
In humans, body (or somatic) cells are diploid, containing two
sets of chromosomes (one from each parent).
To maintain this state, the egg and sperm that unite during
fertilization must be haploid, with a single set of
chromosomes.
During meiosis, each diploid cell undergoes two rounds of
division to yield four haploid daughter cells — the gametes.
Meiosis
Humans have 46 chromosomes in almost every cell, 23 that
came from one of our parents and 23 very similar
chromosomes that came from the other one of our parents.
It is really important to have the right number of
chromosomes in a cell.
If a cell has extra chromosomes or is missing a chromosome,
that can have very substantial impacts on how it functions.
Meiosis
We can think of meiosis as a way cells very carefully count and
divide their chromosomes so that each gamete, each egg or
sperm, has exactly 23 chromosomes.
Then when an egg with its 23 chromosomes is fertilized by a
sperm with its 23 chromosomes, the resulting fertilized egg
has exactly 46 chromosomes.
And a new human that grows from that fertilized egg will have
46 chromosomes in all of its cells.
Meiosis
• Produces 4 haploid daughter cells through 2 divisions from parent cell
• Only in germ (reproductive) cells, not in somatic (body) cells
• “reduction division”
• Chromosome number is reduced during first division
• Second division maintains chromosome number
• Bivalents are formed during prophase I
• Dissociate during anaphase I to produce dyads consisting of two identical DNA strands
(chromatids) attached at centromere
• Chromatids of dyad dissociate during anaphase II
• Chromosome number is maintained (count centromeres)
• Meiosis II is similar to a mitotic division
Meiosis
Stages of
Meiosis
Meiosis
Meiosis I
Before entering meiosis I, a cell must first go through interphase.
As in mitosis, the cell grows during G1​ start subscript, 1, end
subscript phase, copies all of its chromosomes during S phase, and
prepares for division during G2​ start subscript, 2, end subscript phase.
Meiosis
Meiosis I
During prophase I, differences from mitosis begin to appear.
As in mitosis, the chromosomes begin to condense, but in meiosis I,
they also pair up.
Each chromosome carefully aligns with its homologue partner so that
the two match up at corresponding positions along their full length.
Meiosis
Meiosis I
For instance, in the image below, the letters A, B, and C represent
genes found at particular spots on the chromosome, with capital and
lowercase letters for different forms, or alleles, of each gene.
The DNA is broken at the same spot on each homologue—here,
between genes B and C—and reconnected in a criss-cross pattern so
that the homologues exchange part of their DNA.
Meiosis
Meiosis I
Early Prophase I
• 5 phases: leptotena, zygotena,
pachytena, diplotena, diakinesis
• Synapsis occurs
• Homologous chromosomes recognize each
other
• Align across entire length to form tetrad (4
chromatids in synaptonemal complex)
• Crossing over occurs
• Begins in zygotena prior to completion of
synapsis, continues into pachytena
Crossing over

Paired homologous chromosomes

exchange information (DNA)
Metaphase I
• Homologous pairs of chromosomes
(bivalents) line up together at
metaphase plate (unlike in mitosis)
• Duplicated DNA strands (sister
chromatids) DO NOT separate during
anaphase
Anaphase I and Telophase I
Meiosis II
MITOSIS MEIOSIS

Cell Division Chiasma MEIOSIS I

Parent cell
Chromosome Chromosome
Prophase replication replication Prophase I
Homologous
Mitosis Replicated chromosome 2n = 6
chromosome
pair

& Meiosis
Metaphase Metaphase I

Anaphase Anaphase I
Telophase Telophase I
Haploid
n=3
Daughter
cells of
meiosis I
2n 2n MEIOSIS II
Daughter cells n n n n
of mitosis Daughter cells of meiosis II
THE BASIC STRUCTURE OF DNA
• DNA is like a twisted
ladder
DNA: THE BASIC STRUCTURE OF DNA

• DNA is made of many

nucleotides
• NUCLEOTIDE =
BASE + PHOSPHATE
+ DEOXYRIBOSE
SUGAR
The bases of DNA

• There are two types of bases PURINE and

PYRIMIDINE
• Purine bases: Adenine (A) and Guanine
(G)
• Pyrimidine bases: Thymine (T) and
Cytosine (C)
Chargaffs Rules

1. Ratio of Purines to Pyrimidines = 1 (A+G)=(T+C)

2. Ratio Adenine to thymine =1 (A/T=1)
3. Ratio Guanine to cytosine =1 (G/C=1)
COMPLEMENTARY BASE PAIRING

• IN DNA
• base A ALWAYS bonds (joins) with base
T
• base G ALWAYS bonds (joins) with
base C
DNA
• The two chains of the DNA molecule are COMPLEMENTARY
• If you are given the sequence of bases on one strand
• You can complete the sequence of bases on the second
strand by complementary base pairing
• If one chain is 3’ – AGCTAC-5’
• The complementary chain would be
• 5’- TCGATG -3’
PURPOSE OF DNA REPLICATION
Gives daughter cells produced by cell division a
complete set of genetic information identical to the
parent cell.
WHERE REPLICATION OCCURS
Nucleus
WHEN DURING THE CELL CYCLE REPLICATION OCCURS
Interphase (S)
HOW REPLICATION OCCURS
1. Helicase enzymes unzip the parent strand by
separating the nitrogen base pairs.
2. DNA polymerase pairs free DNA nucleotides with
the exposed bases on both strands following the base
pair rules.
• each strand from the parent molecule serve as a
template
3. Hydrogen bonds reform spontaneously sealing the
two strands of each DNA molecule together.
RESULTS OF REPLICATION
• Two molecules of DNA that are identical
• Each is half old (strand from parent) and half new
(strand synthesized by DNA polymerase)
Protein Synthesis
Transcription and Translation

30
RNA Transcription
• The cell does not directly use DNA
to control the function of the cell.
• DNA is too precious and must be
kept protected within the nucleus.
• The Cell makes a working
"Photocopy" of itself to do the
actual work of making proteins.
• This copy is called Ribonucleic Acid
or RNA.
• RNA differs from DNA in several
important ways.
1. It is much smaller
2. It is single-stranded
3. It does NOT contain Thymine,
but rather a new nucleotide
called Uracil which will bind to
Adenine
4. Contains ribose, not
deoxyribose sugar

31
RNA Transcription
• RNA is produced through a process called RNA Transcription.
• Similar to DNA Replication.
• Small area of DNA "Unzips" exposing Nucleotides
• This area is acted on by an enzyme called RNA Polymerase,
which binds nucleotides (using uracil) to their complementary
base pair.
• This releases a long strand of Messenger RNA (mRNA) which
is an important component of protein synthesis.

32
RNA Transcription

33
Protein Synthesis & The Genetic Code
• The Sequence of nucleotides in an mRNA strand determine the
sequence of amino acids in a protein
• Process requires mRNA, tRNA & ribosomes
• Polypeptide chains are synthesized by linking amino acids together
with peptide bonds

34
mRNA
• Each three Nucleotide
sequence in an mRNA
strand is called a
"Codon“
• Each Codon codes for
a particular amino
acid.
• The codon sequence
codes for an amino
acid using specific
rules. These specific
codon/amino acid
pairings is called the
Genetic Code.

35
tRNA

•There is a special form of RNA called

Transfer RNA or tRNA.
•Each tRNA has a 3 Nucleotide sequence
on one end which is known as the
"Anitcodon"
•This Anticodon sequence is
complimentary to the Codon sequence
found on the strand of mRNA
•Each tRNA can bind specifically with a
particular amino acid.

36
Ribosome
• Consists of two subunits
made of protein & rRNA
–Large subunit
–Small subunit
• Serves as a template or
"work station" where
protein synthesis can
occur.

37
Protein Synthesis
• First, an mRNA strand binds to the large & small subunits of a
ribosome in the cytosol of the cell
• This occurs at the AUG (initiation) codon of the strand.
• The ribosome has 3 binding sites for codons --- E (exit site), P,
and A (entry site for new tRNA)
• The ribosome moves along the mRNA strand

38
Protein Synthesis
• An anticodon on tRNA binds to a complementary codon on
mRNA.
• The tRNA carrying an amino acid enters the A site on the
ribosome
• The ribosome moves down the mRNA so the tRNA is now
in the P site and another tRNA enters the A site
• A peptide bond is formed between the amino acids and
the ribosome moves down again
• The first tRNA is released, and another tRNA binds next to
the second, another peptide bond is formed.
• This process continues until a stop codon (UAG…) is
reached.
• The completed polypeptide is then released.

39
Protein Synthesis

40
Replication Problem
• Given a DNA strand with the following nucleotide sequence, what is
the sequence of its complimentary strand?

• 3’- TACCACGTGGACTGAGGACTCCTCTTCAGA -5’

41
Answer
• Given a DNA strand with the following nucleotide sequence, what is
the sequence of its complimentary strand?

• 3’- TACCACGTGGACTGAGGACTCCTCTTCAGA -5’

• 5’- ATGGTGCACCTGACTCCTGAGGAGAAGTCT -3’

42
RNA Transcription Problem
• Given a DNA strand with the following nucleotide sequence, what is
the sequence of its complimentary mRNA strand?

• 3’- TACCACGTGGACTGAGGACTCCTCTTCAGA -5’

43
ANSWER
• Given a DNA strand with the following nucleotide sequence, what is
the sequence of its complimentary mRNA strand?

• 3’- TACCACGTGGACTGAGGACTCCTCTTCAGA -5’

• 3’- AUGGUGCACCUGACUCCUGAGGAGAAGUCU -5’

44
Codon / Anticodon
• Given a mRNa strand with the following nucleotide sequence, what
are the sequence (anticodons) of its complimentary tRNA strands?

• 3’- AUGGUGCACCUGACUCCUGAGGAGAAGUCU -5’

45
Answer
Given a mRNA strand with the following nucleotide
sequence, what are the sequence (anticodons) of its
complimentary tRNA strands?

• 3’- AUGGUGCACCUGACUCCUGAGGAGAAGUCU -5’

• 3’ – UACCACGUGGAUGAGGACUCCUCUUCAGA -5’

46
Protein Translation
• Given the following
sequence of mRNA,
what is the amino acid
sequence of the
resultant polypeptide?

• AUGGUGCACCUGACUC
CUGAGGAGAAGUCU

47
Protein Translation / Answer
• Given the following sequence
of mRNA, what is the amino
acid sequence of the resultant
polypeptide?

• AUGGUGCACCUGACUCC
UGAGGAGAAGUCU

Met-val-his-leu-thr-pro-glu-glu-lys-ser
48