DBT-HRD Training Manual

Isolation of Genomic DNA


What is Genomic DNA?
Genomic DNA constitutes the total genetic information of an organism. The

genomes of almost all organisms are DNA, the only exceptions being some viruses that
have RNA genomes. Genomic DNA molecules are generally large, and in most organisms
are organized into DNA–protein complexes called chromosomes. The size, number of
chromosomes, and nature of genomic DNA varies between different organisms. Bacteria
have a single, circular chromosome. In eukaryotes, most genomic DNA is located within
the nucleus (nuclear DNA) as multiple linear chromosomes of different sizes.
General Remarks on Handling Genomic DNA
DNA is a relatively stable molecule. However, introduction of nucleases to DNA

solutions should be avoided as these enzymes will degrade DNA. Genomic DNA consists
of very large DNA molecules, which are fragile and can break easily. To ensure the
integrity of genomic DNA, excessive and rough pipetting and vortexing should be
avoided. DNA is subject to acid hydrolysis when stored in water, and should therefore be
stored in TE buffer.
Sample Storage
The quality of the starting material affects the quality and yield of the isolated
DNA. The highest DNA yield and quality is achieved by purifying genomic DNA from
freshly harvested tissues and cells. If samples cannot be processed immediately after
harvesting, they should be stored under conditions that preserve DNA integrity. In
general, genomic DNA yield will decrease if samples, particularly animal samples, are
stored at either 2–8°C or –20°C without previous treatment. In addition, repeated
freezing and thawing of frozen samples should be avoided as this will lead to genomic
DNA of reduced size. Recommendations for storage of different starting materials are
discussed below.
Blood
An anticoagulant should be added to blood samples that will be stored. For

example, blood samples treated with heparin or EDTA can be stored at 2–8°C for a few
days, or at –20°C or –80°C for a few weeks. Alternatively, blood samples can be treated
with ACD Solution B (0.48% citric acid, 1.32% sodium citrate, 1.47% glucose; use 1 ml per
DBT-HRD National Training in Molecular Biology & Biotechnology, ICAR-CIFE, Mumbai 241
6 ml blood) and stored for at least 5 days at 2–8°C or 1 month at –20°C. For long-term
storage, blood nuclei can be prepared and stored at –20°C.
Animal tissue
Freshly harvested tissue can be immediately frozen and stored at –20°C, –80°C,
or in liquid nitrogen. Lysed tissue samples can be stored in a suitable lysis buffer for
several months at ambient temperature. Animal and human tissues can also be fixed for
storage using alcohol and formalin; however, long-term storage of tissues in formalin
will result in chemical modification of the DNA.
Reagents required
1. EDTA stock solution (0.5M, pH 8.0)
Dissolve 18.612 g of EDTA.2H2O in 50 ml of dH20. Stir vigorously on a magnetic

stirrer. Adjust the pH to 8.0 with NaOH (~2 g of NaOH pellets). Raise volume to 100
ml with dH20. Aliquot and sterilize by autoclaving.
2. Tris buffer stock solution (1M, pH 8.0)
Dissolve 12.114 g Tris buffer in to 50 ml of dH20; adjust pH to 8.0 with 1 N HCl and
raise volume to 100 ml with distilled water. Autoclave.
3. Sodium chloride (5M)
Dissolve 29.2 g Sodium chloride in 80 ml of dH20 and raise the volume to 100ml.
4. Lysis buffer (1X TEN : 10mM Tris HCl (pH 8.0), 1mM EDTA (pH 8.0), 0.1M NaCl)
Add 1 ml (1M Tris) + 200 µl (0.5M EDTA) + 2 ml (5M NaCl) in 100 ml of dH20.
Autoclave.
5. TE (10 mM Tris and 1 mM EDTA)
Add 1.25ml (Tris 1M) to 0.5 ml EDTA (250 mM) and make up the volume to 125 ml by
adding dH20. Autoclave.
6. 10% SDS: Dissolve 10 g of SDS in 100 ml of autoclaved dH20.
7. 70% ethanol: Mix 70 ml ethanol with 30 ml of autoclaved dH20.
8. Chloroform: isoamyl alcohol (24:1) Mix :
Add 96 ml of Chloroform with 4 ml of Isoamyl alcohol.
9. Proteinase K: 20 mg / ml in autoclaved dH20. Store at - 20C.
10. Isopropanol
11. Tris saturated phenol
Take 1.25 ml of 1M Tris, pH 8.0, in measuring flask and make up to 125 ml by

adding distilled water.
Weigh 15g of phenol and dissolve it completely in a beaker containing above
prepared Tris (10 mM).
Add hydroxyquinoline to a final concentration of 0.1%.
Allow the phenol and water layer to separate. Lower layer is phenol.
After 20 – 30 minutes, pipette out the water layer without disturbing the phenol
layer. Repeat the procedure until the pH of phenol becomes 8.0, as checked by
Hydroxyquinoline - is an antioxidant and a weak chelator of metal ions. In

addition to this its pale yellow colour provides a convenient way to identify the
organic phase.
The pH of the phenol must be ~8.0 to prevent DNA from becoming trapped at the
interface between the organic and aqueous phases.
pH indicator paper.
Again add remaining 10mM Tris, mix it properly and transfer in to brown bottle
and keep in the refrigerator.
Protocol
Cell lysis
Complete disruption and lysis of cell walls and plasma membranes of cells and
organelles is an absolute requirement for all genomic DNA isolation procedures.
Incomplete disruption results in significantly reduced yields.
Blood sample
1. Take 200 l of blood sample (stored in methanol) in a separate eppendorf tube

and centrifuge at 6000 rpm at 4o C for 10 minutes and decant to remove
methanol.
2. Fill the tubes with normal saline and centrifuge at 6000 rpm for 10 minutes and
decant the supernatant. Repeat twice to ensure that whole methanol is
removed.
3. Suspend the cells in 500 l of TEN buffer.
4. To each tube add 5 l of proteinase K and 50 l of SDS and mix thoroughly and
incubate at 55 oC for 2 hr for lysing the cells.
Animal tissues and cell culture
1. Take 100-200 mg of tissue in a 2 ml microfuge tube and cut into small pieces
using sterile forceps and scissors. Homogenize with the help of automated
homogenizer or mortar and pestle.
2. Add 500 µl of TEN buffer, 50 µl of 10% SDS and 5 µl of proteinase K, mix properly
by inverting the tube several times and incubate at 55oC overnight.
Tip For fixed tissues, the fixative should be removed prior to lysis. Formalin can be
removed by washing the tissue in PBS. Paraffin should similarly be removed from
paraffin-embedded tissues by extraction with xylene followed by washing with
ethanol.
Phenol Extraction
1. After cell lysis, add equal volume of Tris-saturated phenol to the lysate and mix
well till emulsion forms.
2. Centrifuge the tubes at 10,000 rpm for 10 min at 4ºC and collect the aqueous
phase in a fresh tube.
Tip If the organic and aqueous phases are not well separated, centrifuge again for long
time.
Tip The organic phase is easily identifiable because of the yellow colour contributed by
the 8-hydroxyquinoline that is added to phenol during equilibration.
3. To each tube, add equal volume of Phenol:chloroform-isoamyl alcohol (25:24:1)

and mix by inverting the tube several times till emulsion forms.
4. Centrifuge the tubes at 10,000 rpm for 10 minutes at 4ºC.
5. Transfer the aqueous phase in a separate tube and add equal volume of
chloroform-isoamyl alcohol (24:1), mix well and centrifuge at 10,000 rpm for 10
min at 4ºC.
6. Transfer the clear aqueous phase into a fresh 1.5 ml microfuge tube.
Isopropanol Precipitation
7. Adjust the salt concentration if necessary, for example, with sodium acetate (0.3
M, pH 5.2, final concentration) or ammonium acetate (2.0–2.5 M, final
concentration).
8. Add 0.6–0.7 volumes of room-temperature isopropanol to the DNA solution and

mix well.
Tip Use all solutions at room temperature to minimize co-precipitation of salt.
Tip Do not use polycarbonate tubes for precipitation as polycarbonate is not resistant to
isopropanol.
9. The tubes are centrifuged at 10,000 for 10 minutes.
10. Remove the supernatant and wash the precipitate twice with 500 l of 70 %
alcohol. This removes co-precipitated salt and replaces the isopropanol with the
more volatile ethanol, making the DNA easier to redissolve.
11. Air dry the DNA pellet for 15-20 minutes.
Tip Do not over dry the pellet (e.g., by using a vacuum evaporator) as this will make
DNA, especially high-molecular-weight DNA, difficult to redissolve.
12. Resuspend the DNA in appropriate volume of TE buffer and store at 4oC.
Tip Choose an appropriate volume of buffer according to the expected DNA yield and
the desired final DNA concentration. Use a buffer with a pH of 7.5–8.0, as DNA does
not dissolve easily in acidic buffers. (If using water, check pH.)
Tip High-molecular-weight DNA, such as genomic DNA, should be redissolved very

gently to avoid shearing, e.g., at room temperature overnight or at 55°C for 1–2 h
with gentle agitation.
13. Quantify the DNA using UV spectrophotometer and check the quality by running
on 0.8% agarose gel. Store at 4oC.
Isolation of eDNA from soil sample
Isolation of Environmental DNA (eDNA)

from soil sample
What is eDNA?
Environmental DNA (eDNA) is genetic material obtained directly from

environmental samples (soil, sediment, water, etc.) without isolating the individual
organisms or their parts
General Remarks on Handling Genomic DNA
Obtaining information of species, populations and communities by retrieving

DNA from environmental samples (environmental DNA – eDNA) holds the potential of
combating many of the challenges associated with biodiversity monitoring. The fact that
DNA from higher organisms persists in the environment, where it can be sampled,
extracted and analyzed, has been a major technological and scientific breakthrough
within the last decade. As species interact with the environment, they will continuously
expel DNA to their surroundings. For higher organisms, this DNA may come from
excreted cells or tissue such as urine, faces, hairs and skin, and obviously from dead
individuals leaking genetic material. The microbial eDNA may in some systems exists
predominantly inside mitochondria or small cells, but owing to eventual membrane
degradation, extracellular DNA will also be present in the environment. eDNA has been
used to address applied and fundamental research questions within areas ranging from
molecular biology, ecology, palaeontology and environmental sciences.
CTAB (Cetyl trimethylammonium bromide) being a quaternary cationic surfactant

(detergent) has a great role in efficient DNA isolation. A modified CTAB DNA isolation
method can be used to extract the eDNA from the soil sample. Once the sample has
been sufficiently ground, it can then be resuspended in CTAB extraction buffer. The
extraction buffer along with Proteinase K and SDS, disrupts the cell wall, remove the
secondary metabolites, debris, proteins and exploit the nucleic acid material without
degradation. In order to purify DNA, insoluble particulates are removed through
centrifugation while soluble proteins and other material are separated through mixing
with chloroform and centrifugation. DNA is then precipitated from the aqueous phase
and washed thoroughly to remove contaminating salts. The purified DNA is then
resuspended and stored in buffer or sterile distilled water. This method has been shown
to give intact eDNA from soil sample.
Reagents required
1. Extraction buffer:
 100 mM Tris-HCl pH-8
 100 mM EDTA-Na pH-8
 100 mM Na-phosphate pH-8
 1.5 M NaCl
 1% CTAB (cetyltrimethylammonium bromide)
2. Proteinase K solution:
 10 mg proteinase K (-20°C freezer)
 1 ml buffer:
 50 mM Tris-HCl pH8
 1.5 mM Ca-acetate. Store at - 20C.
3. 20% SDS: Dissolve 20 g of SDS in 100 ml of autoclaved dH20.
4. 70% ethanol: Mix 70 ml ethanol with 30 ml of autoclaved dH20.
5. Chloroform: isoamyl alcohol (24:1) Mix :
Add 96 ml of Chloroform with 4 ml of Isoamyl alcohol.
6. Isopropanol
7. TAE (1x) buffer:

 Tris-HCl (available as 50x stock solution)
 Acetic acid
 EDTA
Protocol
1. Collect a fresh or preserved sample of 5 g of soil (try to avoid roots and other
plant parts)
2. In a 50 ml Falcon tube, suspend 5 g soil in 13.5 ml extraction buffer and add 100
μl of proteinase K solution (10 mg/ml).
Note: If possible the soil sample should be air dried and grinded to fine particles,
otherwise vortex or spinner should be used for complete mixing of the buffer with
the soil.
3. Incubate flask at 37°C in orbital shaker or in a shaking incubator for 30 minutes
@ 200rpm.
4. Add 1 ml of 20% SDS solution.
5. Incubate flask at 65°C (waterbath) for 60 minutes. Gently shake up suspension in
every 15-20 minutes.
6. Centrifuge the samples at 5000 rpm in room temperature for 15 minutes.

7. Collect supernatant from tube in separate, fresh Falcon tube and keep at room
temperature.
8. Completely resuspend bottom soil pellet again in 5 ml extraction buffer and 0.5
ml SDS solution using a sterile stick or by vortex and incubate another 10 minutes
at 65°C in waterbath.
9. Centrifuge the samples at 5000 rpm @ room temperature for 15 minutes.
10. Collect supernatant from tube and combine with previously collected material
(step 7).
11. Repeat washing steps 8-10 one more time.
12. Add equal volume of chloroform: isoamyl alcohol with the combined supernatant
(~25 ml) in Falcon tube. Mix well. Centrifuge at 2000 rpm @ room temperature
for 10 minutes.
13. Carefully recover the upper (aqueous) layer into a autoclaved 30 ml Centrifuge
tube. Do not transfer solid material on the interface.
14. Add 0.6 – 0.7 volumes (60% to 70% of total aqueous layer) of isopropanol to
aqueous layer, close vials, and invert 4-6 times.
15. Incubate vials for 60 minutes at room temperature.
16. Balance the weight of the vials. Weight difference must be < 0.1 g due to the high
g-forces in the floor centrifuge (~23000 x g).
Note: Weight difference may lead to dispersed pellet formation in centrifugation. So

compensate the weight difference by adding isopropanol.
17. Place vials in floor centrifuge and spin at 15000 rpm @ 20°C for 30 minutes or
12000 rpm @ 20°C for 40 minutes.
Note: the pellet will be of reddish black colour due to the pigments and variety of
DNA in the soil. Whitish pellet suggests salt precipitation and need a further washing
with 20 ml Tris buffer (50 mM, pH7.5) and repeat isopropanol incubation (13 ml) for
60 minutes, followed by centrifugation @ 12000 rpm for 40 minutes at room
temperature.
18. Pour off supernatant completely and let pellet air-dry for 5-10 minutes.
19. Redissolve pellet in 500 μl TAE (1x) use open spinner/vortex to dissolve.
20. Transfer the dissolved pellets to a 1.5 ml or 2 ml tube and store at 4°C.
21. Quantify the DNA using UV Spectrophotometer or Nanodrop machine. Check the
quality by running the DNA on 1% agarose gel.
Reference
Lab protocol for eDNA isolation, Stefan Lutz, Lutz research group, Department of
Chemistry, Emory University http://lutz4.chem.emory.edu/CHEM346L/webdata/
Components/Step1_DNAextraction.pdf
RNA isolation
RNA isolation
What is RNA?
RNA is a biological macromolecule that serves a number of different functions.

Messenger RNA (mRNA), transcribed from DNA, serves as a template for synthesis of
proteins. Protein synthesis is carried out by ribosomes, which consist of ribosomal RNA
(rRNA) and proteins. Amino acids for protein synthesis are delivered to the ribosome on
transfer RNA (tRNA) molecules. RNAs are also part of riboproteins involved in RNA
processing.
A typical mammalian cell contains 10–30 pg total RNA. The majority of RNA
molecules are tRNAs and rRNAs. mRNA accounts for only 1–5% of the total cellular RNA
although the actual amount depends on the cell type and physiological state.
Approximately 360,000 mRNA molecules are present in a single mammalian cell, made
up of approximately 12,000 different transcripts with a typical length of approximately 2
kb. Some mRNAs comprise as much as 3% of the mRNA pool whereas others account for
less than 0.01%. These “rare” or “low abundance” messages may have a copy number of
only 5–15 molecules per cell.
Compared to DNA, however, RNA is relatively unstable. This is largely due to the
presence of ribonucleases (RNases), which break down RNA molecules. RNases are very
stable, do not require cofactors, are effective in very small quantities, and are difficult to
inactivate. RNase contamination can come from human skin and dust particles, which
can carry bacteria and molds. Isolation and analysis of RNA therefore requires
specialized techniques.
General Remarks on Handling RNA
Since RNases are difficult to inactivate and even minute amounts are sufficient to
destroy RNA, all plasticware or glassware should be treated to eliminate possible RNase
contamination. Great care should be taken to avoid inadvertently introducing RNases
into the RNA sample during or after the isolation procedure. In order to create and
maintain an RNase-free environment, the following precautions should be followed
while working with RNA.
General handling
Proper microbiological, aseptic technique should always be used when working

with RNA. Hands and dust particles may carry bacteria and molds and are the most
RNA isolation
common sources of RNase contamination. Always wear latex gloves while handling
reagents and RNA samples to prevent RNase contamination from the surface of the skin
or from dusty laboratory equipment. Change gloves frequently and keep tubes closed
whenever possible. Keep isolated RNA on ice when aliquots are pipetted for
downstream applications.
Disposable plasticware
The use of sterile, disposable polypropylene tubes is recommended when

working with RNA. These tubes are generally RNase-free and do not require
pretreatment to inactivate RNases.
Non-disposable plasticware
Non-disposable plasticware should be thoroughly rinsed with 0.1 M NaOH, 1 mM

EDTA followed by RNase-free water. Alternatively, chloroform-resistant plasticware can
be rinsed with chloroform to inactivate RNases.
Glassware
Glassware used for RNA work should be cleaned with a detergent, thoroughly
rinsed, and oven baked at 240°C for at least 4 hours before use. Autoclaving alone will
not fully inactivate many RNases. Alternatively, glassware can be treated with DEPC
(diethyl pyrocarbonate). Fill glassware with 0.1% DEPC (0.1% in water), incubate
overnight (12 hours) at 37°C, and then autoclave or heat to 100°C for 15 minutes to
eliminate residual DEPC.
Note: DEPC is a suspected carcinogen and should be handled with great care. Wear
gloves and use a fume hood when using this chemical.
Electrophoresis tanks
Electrophoresis tanks should be cleaned with detergent solution (e.g., 0.5% SDS),
thoroughly rinsed with RNase-free water, and then rinsed with ethanol and allowed to
dry.
Solutions
Solutions (water and other solutions) should be treated with 0.1% DEPC. DEPC is
a strong, but not absolute, inhibitor of RNases that works by covalently modifying
RNases.
RNA isolation
1. Add 0.1 ml DEPC to 100 ml of the solution to be treated. Shake vigorously to

bring the DEPC into solution.
2. Incubate for 12 h at 37°C and autoclave for 15 min to remove any trace of DEPC.
Tip DEPC will react with primary amines and cannot be used directly to treat Tris
buffers. DEPC is highly unstable in the presence of Tris buffers and decomposes
rapidly into ethanol and CO2. When preparing Tris buffers, treat water with DEPC
first, and then dissolve Tris to make the appropriate buffer.
Tip Trace amounts of DEPC will modify purine residues in RNA by carboxymethylation.
Residual DEPC must always be eliminated from solutions or vessels by autoclaving
or heating to 100°C for 15 min.
Stabilization of RNA in biological samples
Once a biological sample is harvested, its RNA becomes extremely unstable.

Traditionally, samples harvested for RNA analysis are immediately frozen in liquid
nitrogen and stored at –80°C until processed. Stabilization reagents such as RNAlater™
RNA Stabilization Reagent for tissues, RNAprotect™ Bacteria Reagent for bacteria, and
the PAXgene™ Blood RNA System for blood can alternatively be used to stabilize RNA in
biological samples.
Reagents required
1. TRI Reagent (Trizol)
2. Chloroform
3. Isopropanol
4. 70% ethanol: Mix 70 ml ethanol with 30 ml of 0.1% DEPC-treated water.
Protocol
1. Isolate the desired tissues by dissection aseptically and place them immediately
in liquid nitrogen.
2. Transfer 100 mg of the frozen tissue to a mortar containing liquid nitrogen and
pulverize the tissue using a pestle. The tissue can be kept frozen during
pulverization by the addition of the liquid nitrogen.
RNA isolation
3. Transfer the powdered tissue to a polypropylene tube containing 1 ml of ice cold

Trizol reagent.
4. Homogenize the tissue with a homogenizer for 15-30 seconds at room

temperature.
5. Incubate the homogenates for 5 min at room temperature to permit complete

dissociation of nucleoprotein complexes.
6. Add 0.2 ml of chloroform per ml of trizol reagent. Mix the samples by vigorous
shaking or vortexing.
7. Separate the mixture into two phases by centrifuging at 12, 000 rpm for 15 min
at 4oC. Transfer the upper aqueous phase to a fresh tube.
8. To precipitate the RNA, add 0.25 volumes of isopropanol.
9. After thorough mixing, store the final solution for 10 min at room temperature.
10. Pellet the RNA by centrifugation at maximum speed for 10 min at 4oC in a
microfuge.
11. Wash the pellet twice with 75% ethanol made in 0.1% DEPC, and centrifuge
again.
12. Remove any traces of ethanol by air drying. Do not allow pellet to dry
completely.
13. Add 50-100µl of DEPC-treated water and store the RNA solution at -70oC.
14. Quantify the RNA using UV spectrophotometer and check the quality by running
on 1% agarose gel.
Quantification of Nucleic acids
Quantification of Nucleic Acids

Reliable measurement of nucleic acid concentration is important for many
applications in molecular biology. Nucleic acid concentration can be determined by
measuring the absorbance at 260 nm (A260) in a spectrophotometer using a quartz
cuvette. For greatest accuracy, readings should be between 0.1 and 1.0. An absorbance
of 1 unit at 260 nm corresponds to 50 μg/ml for double-stranded DNA and 40 μg/ml for
RNA. This relation is valid only for measurements made at neutral pH, therefore,
samples should be diluted in a low-salt buffer with neutral pH (e.g., Tris Cl, pH 7.0).
Purity of DNA / RNA
The ratio of the readings at 260 nm and 280 nm (A260/ A280) provides an
estimate of DNA / RNA purity with respect to contaminants that absorb UV light, such as
protein. The A260/A280 ratio is influenced considerably by pH. Since water is not
buffered, the pH and the resulting A260/ A280 ratio can vary greatly. Lower pH results in
a lower A260/A280 ratio and reduced sensitivity to protein contamination. For accurate
A260/ A280 values, measure absorbance in a slightly alkaline buffer (e.g., 10 mM Tris·Cl,
pH 7.5). Make sure to zero the spectrophotometer with the appropriate buffer. Pure
DNA has an A260/A280 ratio of 1.8 while RNA has a ratio of 2.0. Scanning the
absorbance from 220–320 nm will show whether there are contaminants affecting
absorbance at 260 nm. Absorbance scans should show a peak at 260 nm and an overall
smooth shape.
Tip Phenol has an absorbance maximum of 270–275 nm, which is close to that of DNA.
Phenol contamination mimics both higher yields and higher purity, because of an
upward shift in the A260 value.
Contaminants
In DNA isolation:
Depending on the DNA isolation method used, RNA will be co-purified. RNA may
inhibit some downstream applications, but it will not inhibit PCR. Spectrophotometric
measurements do not differentiate between DNA and RNA, so RNA contamination can
lead to overestimation of DNA concentration. Treatment with RNase A will remove
contaminating RNA; this can either be incorporated into the purification procedure or
performed after the DNA has been purified.
Quantification of Nucleic acids
Tip Ensure that the RNase A solution has been heat-treated to destroy any
contaminating DNase activity. Alternatively, use DNase-free RNase purchased from
a reliable supplier.
In RNA isolation:
RNA preparations are recommended to be treated with DNase to eliminate

DNA contamination for performing downstream protocols like cDNA synthesis
followed by PCR, qRT-PCR.
Spectrophotometric conversions
1 A260 Unit Concentration (µg/ml)
dsDNA 50
ssDNA 37
RNA 40
Oligonucleotides 20–30
An example of the calculation involved in DNA quantification is shown below:

Volume of DNA sample = 100 μl
Dilution = 10 μl of DNA sample + 490 μl distilled water (1/50 dilution).
Measure absorbance of diluted sample in a quartz cuvette.
A260 = 0.23
Concentration of DNA sample = Spectrophotometric conversion x A260 x dilution factor
= 50 x 0.23 x 50
= 575 μg/ml
Total yield = concentration x volume of sample in milliliters
= 575 μg/ml x 0.1 ml
= 57.5 μg
NanoDrop, is an alternate instrument used for measuring quality and quantity of nucleic
acids. It is easy to operate, fast, more sensitive, requires no additional calculations and
needs only 1μl of sample volume for measurement.
Agarose Gel Electrophoresis

This section is aimed at providing useful hints for effective gel analysis of nucleic
acids. Firstly, the basic steps involved in pouring an agarose gel for DNA analysis are
outlined. Subsequent sections look at loading and running the gel and visualization of
the DNA.
Principle of gel analysis
Gels allow separation and identification of nucleic acids based on charge

migration. Migration of nucleic acid molecules in an electric field is determined by size
and conformation, allowing nucleic acids of different sizes to be separated. However,
the relationship between the fragment size and rate of migration is non-linear, since
larger fragments have greater frictional drag and are less efficient at migrating through
the polymer.
Agarose gel analysis is the most commonly used method for analyzing DNA
fragments between 0.1 and 25 kb. Other specialized analytical gel methods exist for
analyzing extremely large or small DNA molecules.
Concentration of agarose used for separating DNA of different sizes

Agarose concentration (% w/v) DNA fragment range (kb)
0.3* 5–60
0.5 1–30
0.7 0.8–12
1.0 0.5–10
1.2 0.4–7
1.5 0.2–3
2.0* 0.05–2
Reagents required
1. Electrode buffer (TAE - 50X)
242g Tris base + 57.1 ml Glacial acetic acid + 100 ml EDTA (0.5 M; pH 8.0). Final
volume made to 1000 ml. Working buffer concentration – 0.5X
2. Loading dye (6X): 0.25% bromophenol blue + 0.25% xylene cyanol + 30% glycerol
in dH20.
3. Agarose
4. Ethidium bromide (10 mg/ml)
Add 1 g of ethidium bromide to 100 ml of dH20. Stir on magnetic stirrer to ensure

complete dissolution of the dye. Aliquot in eppendorf tube and wrap it with
aluminium foil. Store at room temperature.
Equipments required
1. Horizontal gel electrophoresis equipment
2. Transilluminator or Photodocumentation system
Protocol
Pouring an agarose gel
1. Prepare enough 0.5X running buffer both to pour the gel and fill the
electrophoresis tank.
2. Add an appropriate amount of agarose (depending on the concentration

required) to an appropriate volume of running buffer (depending on the volume
of the gel tray being used) in a flask or bottle.
Tip Always use the same batch of buffer to prepare the agarose as to run the gel, since
small differences in ionic strength can affect migration of DNA.
3. Heat the slurry in a microwave, swirl the vessel occasionally, until the agarose is
dissolved.
Tip Ensure that the lid of the flask is loose to avoid buildup of pressure. Be careful not
to let the agarose solution boil over as it becomes superheated.
Tip If the volume of liquid reduces considerably during heating due to evaporation,
make up to the original volume with distilled water.
4. Cool the agarose to 55–60°C. Add ethidium bromide to a final concentration of

0.5 µg/ml
Tip Mix the agarose–ethidium bromide solution well to avoid localized staining.
Note : Ethidium bromide is a powerful mutagen and is very toxic. Wear gloves and take
appropriate safety precautions when handling. Decontaminate after use.
5. Pour the agarose solution onto the gel tray to a thickness of 3–5 mm. Insert the
comb either before or immediately after pouring. Leave the gel to set (30–40
min).
Tip Ensure that there is enough space between the bottom of the comb and the glass
plate (0.5–1.0 mm) to allow proper formation of the wells and avoid sample
leakage.
6. Carefully remove the comb and adhesive tape, if used, from the gel. Fill the tank
containing the gel with electrophoresis buffer.
Tip Add enough buffer to cover the gel with a depth of approximately 1 mm liquid
above the surface of the gel. If too much buffer is used the electric current will flow
through the buffer instead of the gel.
Running an agarose gel
1. Prepare samples by mixing 1 volume of gel loading dye to 5 volumes of DNA

sample.
2. Apply samples in gel loading buffer to the wells of the gel.
Tip Once samples are loaded, do not move the gel tray/tank as this may cause samples
to float out of the wells.
3. Connect the electrodes so that the DNA will migrate towards the anode (positive
electrode).
4. Turn on the power supply and run the gel at 5-8 V/cm until the dyes have
migrated an appropriate distance. This will depend on the size of DNA being
analyzed, the concentration of agarose in the gel, and the separation required.
Tip Avoid use of very high voltages which can cause trailing and smearing of DNA bands
in the gel, particularly with high-molecular-weight DNA.
Visualization
After putting off the power supply the gel is then placed on a UV-transilluminator
or gel documentation system to visualize and photograph the DNA bands. Ethidium
bromide–DNA complexes display increased fluorescence compared to the dye in
solution. This means that illumination of a stained gel under UV light (254–366 nm)
allows bands of DNA to be visualized against a background of unbound dye. The gel
image can be recorded using a gel documentation system.
Note : UV light can damage the eyes and skin. Always wear suitable eye and face
protection when working with a UV light source.
Tip UV light damages DNA. If DNA fragments are to be extracted from the gel, use a
lower intensity UV source if possible and minimize exposure of the DNA to the UV
light.
cDNA preparation and RT-PCR

Reverse Transcriptase PCR (RT–PCR) is a one or two step process that is
undergone when converting RNA to DNA and the subsequent amplification of the DNA
that has been reversely transcribed.
In the first step of RT-PCR, which is called the first strand cDNA synthesis, the
complementary DNA (cDNA) is produced from an mRNA template that uses dNTPs and a
reverse transcriptase. The components mentioned are combined with a primer (Oligo
(dT) or random primer) in a reverse transcriptase buffer for approximately one hour at a
temperature of 37oC.
When the reverse transcriptase reaction has been completed a cDNA will have
been produced from the original single stranded mRNA. At this point standard PCR, or
second strand reaction, is performed. In this two step RT–PCR, Taq DNA polymerase and
the upstream and downstream DNA primers are added. The reaction is further helped
by putting it in a temperature that is above 37oC will aid in binding DNA primers to the
cDNA. The subsequent higher temperatures will let the DNA polymerase to produce
double stranded DNA from the cDNA.
Reagents required
1. Total RNA (or mRNA)

2. Oligo (dT)18 primer
3. Reverse transcriptase
4. dNTPs
5. Taq DNA polymerase
6. RNase Inhibitor
Protocol
1. Transfer 1-3 µg of Total RNA (or 100 ng of mRNA) to a fresh microfuge tube.
DNase treatment is recommended to avoid DNA contamination.
Total RNA 1-3 µg
DNase enzyme 1 unit
DNase buffer 1x
Adjust the volume to 10µl with Nuclease free water. Incubate at 37oC for 30
mins. Add 25mM EDTA and incubate at 65oC for 10 mins. Chill on ice.
Take 1-3 µg of DNase treated RNA, Add following:

Total RNA 1-3 µg
Oligo (dT)18 primer 0.5 µg
Nuclease free water to make up the volume to 12.5 µl
Incubate at 65oC for 5 mins. This step denatures RNA and removes any secondary
structures.
2. To the denatured RNA add:

RT buffer 1x
dNTPs 20 mM
RNase Inhibitor 20 units
Reverse transcriptase 40 units
Nuclease free water to make up the volume to 20 µl
3. Incubate the reaction for 60 min at 42oC.
4. Inactivate the reverse transcriptase and denature the template-cDNA complexes

by heating the reaction to 70oC for 5 minutes.
5. The first strand cDNA can then be used to amplify a specific DNA fragment by
normal PCR reaction using specific sense and antisense primers.
PCR Primer Designing

PCR is a powerful tool that allows amplification of specific DNA sequences.
Prerequisites for successful PCR include the design of optimal primer pairs, the use of
appropriate primer concentrations, and optimization of the PCR conditions.
Core parameters in primer design

Tm, Primer Length, and GC Content (GC %)
Heat will separate or “melt” double-stranded DNA into single-stranded DNA by
disrupting its hydrogen bonds. Tm (melting temperature) is the temperature at which
half the DNA strands are single-stranded and half are double-stranded. Tm characterizes
the stability of the DNA hybrid formed between an oligonucleotide and its
complementary strand and therefore is a core parameter in primer design. It is affected
by primer length, primer sequence, salt concentration, primer concentration, and the
presence of denaturants (such as formamide or DMSO).
All other conditions set, Tm is characteristic of the primer composition. Primer

with higher G+C content (GC %) has a higher Tm because of more hydrogen bonds (three
hydrogen bonds between G and C, but two between A and T). The Tm of a primer also
increases with its length.
Primer specificity
To amplify only the intended fragment, the primers should bind to the target
sequence only but not somewhere else. In other words, the target sequence should
occur only once in the template. Primer length not only affects the Tm, but also the
uniqueness (specificity) of the sequence in the template. Suppose the DNA sequence is
entirely random (which may not be true), the chance of finding an A, G, C, or T in any
given DNA sequence is one quarter (1/4), so a 16 base primer will statistically occur only
once in every 416 bases, or about 4 billion bases, which is about the size of the human
genome. Therefore, the binding of a 16 base or longer primer with its target sequence is
an extremely sequence-specific process. However, it is often useful to search the current
DNA sequence databases to check if the chosen primer has gross homology with
repetitive sequences or with other loci elsewhere in the genome. For genomic DNA
amplification 17-mer or longer primers are routinely used.
Secondary structure (Hairpin and Dimer) Formation

The hardest part in PCR primer design is to avoid primer complementarity,
especially at the 3' ends. When part of a primer is complementary to another part of
itself, the primer may fold in half and form a so-called hairpin structure, which is
stabilized by the complementary base pairing. The hairpin structure is a problem for PCR
because the primer is interacting with itself and is not available for the desired reaction.
Furthermore, the primer molecule could be extended by DNA polymerase so that its
sequence is changed and it is no longer capable of binding to the target site.
Similar to the hairpin structure, if not carefully designed, one primer molecule
may hybridize to another primer molecule and acts as template for each other, resulting
in primer-dimers. Primer-dimer formation causes the same problems to PCR reaction as
the hairpin structure. It may also act as a competitor to amplification of the target DNA.
Usually it is very hard and time-consuming to catch the hairpin structure or primer-
dimer formation manually by a naked eye. However, they can be easily detected by
primer analysis programs.
General Rules for Primer design

The following points should be considered when designing primers for PCR.
Length: 18–30 nucleotides
GC content: 40–60%
Tm :
Simplified formula for estimating melting temperature (Tm): Tm = 2°C x (A+T) +
4°C x (G+C)
Whenever possible, design primer pairs with similar Tm values.
Optimal annealing temperatures may be above or below the estimated Tm. As a
starting point, use an annealing temperature 5°C below Tm.
Sequence :
Avoid complementarity of two or three bases at the 3' ends of primer pairs to
reduce primer–dimer formation.
Avoid mismatches between the 3' end of the primer and the target-template
sequence.
Avoid runs of 3 or more G or C at the 3' end.
Avoid a 3'-end T. Primers with a T at the 3' end have a greater tolerance of
mismatch.
Commercially available computer software (e.g., Primer Designer 1.0, Scientific
Software, 1990; Oligo, Rychlik and Rhoads, 1989) can be used for primer design.
Note : The primer and Mg2+ concentration in the PCR buffer and annealing temperature
of the reaction may need to be optimized for each primer pair for efficient PCR.
Computer programs for PCR primer Design

As computers are widely used in molecular biology, a large number of computer
programs have been specifically developed for primer selection, which makes the PCR
primer design more efficient and reliable. Most sequencing analysis packages, such as
Vector NTI (InforMax Inc.), usually contain a primer design module.
From a computational point of view the design of non degenerate PCR primers is
relatively simple: find short substrings from DNA nucleotide string that meet certain
criteria. Although the criteria vary between programs, the core parameters, such as the
primer length, Tm, GC content, and self-complementarity, are shared by these
programs. In this section, we focus on sequence analysis software, Generunner V. 3.04
(Hastings Software Inc).
Open Generunner software
Click File menu and select

nucleic acid sequence.
Copy the desired sequence from

the source file and paste in the
sequence window using Ctrl+V
short cut key.
Go to Analysis menu, click

nucleic acid and select PCR
primers.
PCR Analysis dialog box appears

Modify the parameters as per
the requirements.
Tm: 50-65
Specify the search region when
only a portion of the input
sequence is to be amplified.
PCR primers results page appears

Select the primer pair with
maximum possible Tm and with
desired amplicon size.
Click Oligos button at the bottom of
the results window.
Oligo analysis dialog box appears.

Check all the parameters like Tm, %GC
including dG value for hairpins, dimmers,
bulge loops and internal loops.
The dG value should preferably be either
nil or a positive value.
Avoid negative dG values which mean
the secondary structures are stable and
will result in poor performance.
Press switch oligos button in the right
corner of the window to analyze the
antisense primer parameters.
Save the file
Polymerase Chain Reaction

Introduction
Polymerase chain reaction (PCR), an extremely simple concept, is a very powerful

technique that has changed the way many problems in biological sciences are addressed
since its conception by Mullis in 1983. The technique achieves amplification of DNA from
a single copy of a gene/ DNA sequence to a quantity that can be visualized on an agarose
gel in a short period of 3 hours. So far, no other technique has equaled PCR in sensitivity.
The principle of the technique involves thermal denaturation of the double

stranded target DNA molecules (Fig 1). The next step is annealing of oligonucleotide
primers to the complementary target sequences at a lower temperature (dependent on
the length and sequence of the primer). Thereafter, the primer is extended by the
thermostable Taq DNA polymerase in the presence of dNTPs, resulting in the doubling of
the amount of target DNA in the sample. By repeating this cycle of denaturation,
annealing and extension 30-35 times, the copy number of the target molecule increases
exponentially. Once the amplification is over the product is visualized by running in an
agarose gel.
Fig 1. A schematic representation of the principle of PCR
A typical PCR reaction mixture

Template DNA (Test Sample) 25-100 ng
Primers 10-20 pmoles
dNTP mix 0.2 mM
Reaction buffer (Supplied with Taq polymerase) 1x
Taq polymerase 0.75 units
Autoclaved distilled water to make up to desired volume
The components of the reaction are mixed in PCR tubes and placed in a
thermocycler. This machine can be programmed to provide the temperatures required
for denaturation, annealing and extension for various time periods as per requirement.
A typical PCR program

1. Initial denaturation 94oC 5 min
2. Denaturation 94oC 45 sec
3. Annealing 55-60oC* 45 sec
4. Extension 72oC 60 sec
Steps 2 – 4 repeated 35 times.
5. Final extension 72oC 8 min
Hold Temperature ** 4oC
*Temperature is dependent on specific primer’s length and sequence.
** This step will maintain the temperature at 4oC after completion of the program.
Tip Inclusion of control reactions is essential for monitoring the success of PCR
reactions. Wherever possible, a positive control should be included to check that
the PCR conditions used can successfully amplify the target sequence. As PCR is
extremely sensitive, requiring only a few copies of target template, a negative
control containing no template DNA should always be included to ensure that the
solutions used for PCR have not become contaminated with the template DNA.
Random Amplification of Polymorphic DNA

Principle
Short oligonucleotides of random sequence will, just by chance, be

complementary to numerous sequences within the genome. If two complementary
sequences are present on opposite strands of a genomic region in the correct
orientation and within a close enough distance from each other, the DNA between them
can become amplified by PCR. Each amplified fragment will be independent of all others
and, by chance, will likely be of different length as well; if few enough bands are
amplified, all will be resolvable from each other by gel electrophoresis.
Different oligonucleotides will amplify completely different sets of loci. RAPD

polymorphisms result from the fact that a primer hybridization site in one genome that
is altered at a single nucleotide in a second genome can lead to the elimination of a
specific amplification product from that second genome. If, for example, the random
primer being used has a length of 10 bases, then each PCR product will be defined by 20
bases (10 in the primer target at each end) that are all susceptible to polymorphic
changes.
Polymorphism of amplified fragments are caused by: (1) base substitutions or

deletions in the priming sites, (2) Insertions that render priming sites too distant to
support amplification, or (3) insertions or deletions that change the size of the amplified
fragment
In RAPD it is not possible to distinguish whether a DNA segment is amplified from

a locus that is heterozygous or homozygous. RAPD markers are therefore dominant.
RAPD-PCR
Genomic DNA will be amplified in sterile 0.2ml PCR tube. The final amplification
reactions will be carried out in 25μl reaction volume containing
10X Buffer - 2.5μl
Template - 40-50ng
dNTP - 200mM
Random primer - 20 pmol
MgCl2 - 2mM
Taq Polymerase - 0.75U
DMW - to make up to 25μl
Program the cycler for 30 cycles of denaturation at 94oC for 1 min, annealing at 36oC for
1 min, extension at 72oC for 2 min. Set the initial denaturation at 94oC for 5 min and the
final extension at 72oC for 8 min.
Run the PCR products on 2% agarose gel and observe the band pattern.
Data analysis
POPGENE is a user-friendly computer freeware designed specifically for the

analysis of co-dominant and dominant markers using haploid and diploid data. POPGENE
computes both comprehensive genetic statistics (e.g., allele frequency, gene diversity,
genetic distance, G-statistics, F-statistics) and complex genetic statistics (e.g., gene flow,
neutrality tests, linkage disequilibria, multi-locus structure).
Input files preparation for RAPD Data analysis
Input File Format
Input file for POPGENE analysis consists of the header section and the data. The
header section specifies (1) a job title delimited by /* ... */; (2) number of populations;
(3) number of loci and (4) locus names. The body of data starts with, for each
population, population ID # (optional), population name (optional). The raw data, in free
format and with or without one or more spaces between columns, immediately follow
without blank lines in between. Missing values must be set to “ . ‘‘ for haploids and
dominant markers such as RAPDs (i.e., one digit to score for presence or absence of
allele) and “..” (i.e., two digits) for diploids co-dominant markers in your input file.
Input file format for diploid data, dominant marker

/* Diploid RAPD Data Set */
Number of populations = 2
Number of loci = 28
Locus name :
OPA01-1 OPA01-2 OPA01-3 OPA01-4 OPA01-5
OPA03-1 OPA03-2 OPA03-3 OPA03-4 OPA03-5 OPA03-6
OPA04-1 OPA04-2 OPA04-3 OPA04-4 OPA04-5 OPA04-6 OPA04-7
OPA07-1 OPA07-2 OPA07-3 OPA07-4 OPA07-5 OPA07-6
OPA11-1 OPA11-2 OPA11-3 OPA11-4
name = mumbai
11101 100100 0111010 001000 1001
10110 100100 0011010 001000 0001
11100 100100 0011010 001000 0001
11111 100100 0011010 001010 0001
10110 101100 0011010 001010 1101
11000 100100 1001010 001000 0001
11101 100100 0101010 001000 1001
10110 100100 0000110 111101 0001
11001 100100 0111010 001010 1001

name = chennai
11101 111101 0111010 111000 1111
11101 111100 0011010 001000 1111
11110 100001 1011010 101010 1011
11101 111000 0011010 001011 0001
10101 111111 0011010 111000 0101
11000 100000 0111010 111010 0111
10001 101000 0011010 011000 1001
11101 101111 0011010 011010 1001
Steps to carry out the analysis with POPGENE
1) Click on File on the main menu

bar and Load Data on the File
menu to select appropriate data
sets to be analyzed (in this
version, Co-Dominant and
Dominant Data can be selected
for further analysis).
(2) Upon loading your data file,

click on Co-Dominant on the main
menu bar to select Haploid or
Diploid analysis, depending on
your data type.
(3) Open Haploid Data Analysis or Diploid Data Analysis dialog box to check:
1. If variables (marker loci) or records (individual organisms) are entered as

columns.
2. If your analysis will be carried out for Single Populations, Groups and/or
Multiple Populations.
3. Appropriate Single Locus summary statistics.

4. Appropriate Multilocus summary statistics.
4) You are now prompted a Query

"Do you want to retain all loci for
further analysis ?"
Click on Yes or No to answer the
question.
If your answer is No, then Delete

Locus dialog box pops up for your
selection of loci tobe deleted.
5) Next, answer the question "Do

you want to retain all populations
for further analysis?
If your answer is No, then Delete

Populations dialog box pops up for
your selection of populations to be
deleted.
6) If you selected Groups at step (3),

enter the number of groups in enter
the number of
groups dialog box.
Click OK to open Group Populations

dialog box for grouping of
populations and select appropriate
populations for each group.
(7) If Two-locus LD was checked at

step (3), then you need to select a
significance level (P) to test for
linkage disequilibria between pairs
of loci.
Important: A high P value can

result in an extremely large output
when you have a large number of
alleles/locus, loci and
populations!!! In most cases, P≤
0.05 should be used
(8) If you have correctly completed

steps (1) to (7), then you are
prompted with result.dat output
Window, displaying the results
from the analysis you just chose.
Activate the menu File | Save as...

to save the output into an ASCII file
for further use or cut-and-paste
selected text directly into a
Window-based word processing
package, such as Microsoft Word or
Word Perfect.
Reproducibility of RAPD Markers
Although the RAPD method is relatively fast, cheap and easy to perform in
comparison with other methods that have been used as DNA markers, the issue of
reproducibility has been of much concern since the publication of the technique. In fact,
ordinary PCR is also sensitive to changes in reaction conditions, but the RAPD reaction is
far more sensitive than conventional PCR because of the length of a single and arbitrary
primer used to amplify anonymous regions of a given genome.
Perhaps some primers do not perfectly match the priming sequence,

amplification in some cycles might not occur, and therefore bands remain fainter. The
chance of these kinds of bands being sensitive to reaction conditions of course would be
higher than those with higher intensity amplified with primers perfectly matching the
priming sites. The most important factor for reproducibility of the RAPD profile has been
found to be the result of inadequately prepared template DNA. Differences between the
template DNA concentration of 2 individuals DNA samples result in the loss or gain of
some bands. Since RAPD amplification is directed with a single, arbitrary and short
oligonucleotide primer, DNA from virtually from all sources is amenable to amplification.
Therefore, DNA from the genome in question may include contaminant DNA from
infections and parasites in the material from which the DNA has been isolated. Special
care is needed for keeping out the DNA to be amplified from other sources of DNA.
Factors crucial to generation of reliable RAPD profiles
Targeting of template sites occur under low stringent condition that is adequate
for annealing of short primers and specific enough to provide discrimination of
legitimate and illegitimate amplicons. In general terms, DNA amplification is
characterized by three parameters: specificity, efficiency and fidelity. These parameters
are strongly influenced by the different components of the reaction (Such as primer,
magnesium ions, dNTPS, and Taq polymerase concentrations) and are modulated by
thermocycling conditions such annealing temperature and duration of each phase of
PCR. The careful optimization of amplification components will ultimately result in
reproducible and efficient RAPD- PCR amplifications.
Mg+2 ion is crucial determinant of amplification. Consistent PCR profile can be

obtained with relatively low levels of magnesium (1.5- 4nM) for plant and Animal DNA
and with high levels (4-8mM) for bacteria and fungi. Mg+2 ion requirements are
dependent on the counter ion and other buffer components. Its activity is also
modulated by the concentrations of primer, template and dNTP. An excess of any of
these components can inhibit the amplification reaction due to sequestration of free
Mg+2 ion, while excess of the Mg+2 ion decreases amplification and increases primer –
template mismatching.
The most important variable in the amplification reaction is the ratio between
concentration of primer and template. It has been reported that an increase in primer
concentration resulted in an increased number of bands.
A number of thermal cycling parameters including annealing and template

denaturation temperatures, cycle number, temperature effects on enzyme and nucleic
acids and durations of annealing, denaturation and strand extension are quite crucial.
Temperature affects the interaction between enzyme and nucleic acid and the kinetics
of the amplification reaction. For example, annealing temperature causes changes in
yield, number and distribution of amplification products.
Applications
Genetic analysis with RAPD markers is relatively easy, fast and efficient. Unlike
RFLP, which requires at least 100-folds intact DNA, the RAPD reaction can be performed
with much smaller quantity of target substrate even without prior information on the
organization of genome. RAPD markers have been used extensively for detection of
genetic variation in various fish and shellfish species (Liu et at., 1999). RAPD has also
been used for phylogenetic studies for species and subspecies identification of fish, for
gynogenetic fish identification and for gene mapping studies in fish (Liu et al., 1999).
Drawbacks
Two disadvantages are dominance and low reproducibility due to low stringent
PCR with RAPD. However, Liu et al., 1999, tested the reproducibility by using DNA
templates from several fish isolated at different times. Exact reproducibility was
obtained when concentrations of DNA and primer were kept similar in all the reactions.
It was also observed that generally, amplified products with large sizes (more than 2 kb)
showed low reproducibility. Good reproducibility was obtained with bands between
200-1500 bp.
Development of Microsatellite Markers by Repeat Enriched Genomic DNA Library
Development of Microsatellite Markers by Repeat

Enriched Genomic DNA Library
Introduction
Microsatellites are marker of choice since a long time and different protocols were
developed time to time for its efficient development. Development of microsatellite
markers can be carried out following four approaches: (i) Mining available DNA sequences
from database (ii) by cross-species amplification of microsatellite primers from
phylogenetically related species (iii) by screening genomic libraries and (iv) by using non-
library protocols.
However, repeat enriched genomic library method is widely used and here are the
details of each step involved in the development of microsatellite markers following
enrichment method and its validation.
Step 1: Genomic DNA Isolation
Take approximately 100 mg muscle or fin tissue in a fresh 2 ml microfuge tube

using sterile scissors and forceps and cut into small pieces. To this add 500µl TEN lysis
buffer, 50 µl SDS (10%) and 10µl Proteinase K (1mg/ml) and incubate the tube at 55°C in a
water bath for 18-20 h. After lyses add equal volume of Tris-saturated phenol (pH 8.0) and
mixed gently for proper emulsification and centrifuge the lysate at 10,000 rpm for 10 min.
Collect top aqueous layer carefully into a fresh 2 ml microfuge tube and extracted with
equal volume of phenol: chloroform: isoamyl alcohol (25:24:1 v/v). Once again extract
supernatant with equal volume of chloroform: isoamyl alcohol (24:1 v/v). After
centrifugation transfer the top aqueous layer containing DNA to a fresh microfuge tube
and to this add one-tenth volume of 3M sodium acetate, pH 5.2 and precipitate DNA with
0.6 volumes of isopropanol. Centrifuge the tube at 10000 rpm for 10 min at 4°C to pellet
the DNA and discard the supernatant. Wash the DNA pellet with 70% chilled ethyl alcohol
and centrifuged at 10000 rpm for 5 min to remove excess salt. Air-dry the DNA pellet and
dissolves in an appropriate volume of TE buffer. Add 1 µl of RNase A and incubate at 370C
for 1 h to remove RNA. Keep DNA at 40C for short term and at -20oC for long term storage.
Step 2: Quality Check and Quantification of DNA
Check the integrity of the isolated DNA by agarose gel electrophoresis on 1%

agarose gel. Check 260/280 value (approximately 1.8) in spectrophotometer.
Step 3: Standardization of RE Conditions
Partial RE digestion is performed to yield fragments in the range of 400-1000 bp.

Optimization of RE condition is required as based upon species from which genomic DNA is
isolated condition will also vary. For this set up six digestion reactions in PCR tubes as given
below for different incubation periods (5, 10, 15, 20, 25 and 30 min) at 37°C in
thermocycler. At the end of each incubation period withdraw a tube and place in another
thermocycler set at 85°C for RE inactivation. Remove the tubes and place in ice after 20
min.
Genomic DNA (500ng/µl) : 4µl
Sau3a1 (5U/µl) : 1µl
Buffer (10x) : 2µl
BSA (100x) : 0.1µl
NFW : Added up to final volume
Total volume : 20µl
After reaction completion check the product on 1% agarose gel along with 100 bp
ladder. Further fine-tune digestion condition by testing incubation times between 5 – 10
min, viz. 6, 7, 8, 9 and 10 min.
Step 4: Bulk Digestion
Set up bulk digestion based on the result of above reaction. The condition yielding
maximum fragment in size range of 400-1000 is used here.
Step 5: Adapter Ligation and Amplification of Fragments
Step 5(a): Adapter Preparation
Prepare sticky end adapters with Sau3a1 compatible ends by annealing

Oligo A (GGCCAGAGACCCCAAGCTTCG; 21mer) and Oligo B (GATCCGAAGCTTGGGGTC
TCTGGCC; 25mer) as designed by Bloor et al. (2001).
CTC TTG CTT ACG CGT GGA CTA
3’ A CAC GAG AAC GAA TGC GCA CCT GAT-PO4
The adapter is received in lyophilized form and dissolved in sterile 1X TE buffer, pH

7.0 to obtain a stock solution of 200pmol/µl and stored at -20°C. For adapter preparation
the following components are mixed in a 0.5 ml microcentrifuge tube by gentle pipetting.
Oligonucleotide A (100 pmol/µl) 10µl
Oligonucleotide B (100 pmol/µl) 10µl
Denature the oligo mixture by heating at 80ºC for 2-5 min in a thermocycler
(BioRad) and allow to anneal by leaving to cool at r.t. for 1 h. Make up the volume to 80 μl
with nuclease free water and store at -20ºC until further use (So final concentration of
adapter is 25 pmol/µl).
Step 5(b): Optimization of Adapter Quantity
Set up following pilot ligation reactions taking different quantities of the adapter
(for optimization).
Re digested genomic DNA : 10 µl (1 µg)

Adapter : Variable amount (25, 50, 75, 100 pmol)
Ligase buffer (5X) : 5 µl
T4 DNA Ligase : 1 µl
NFW : To make volume 25
Incubate reaction mixture at 16ºC overnight and confirm by test PCR as given
below.
Step 5(c): Test PCR for Confirmation of Ligation
Set up test PCR reaction mixture as below to find optimum quantity of adapter for
ligation.
Ligation mix from above : 3µl

Oligo A (10 picomole) : 3 µl
PCR Master mix : 12.5 µl
PCR grade water : to make up to 25 µl
The PCR cycling conditions include initial denaturation at 95oC for 5 min follow by
30 cycles of denaturation at 95oC for 50s, annealing at 56ºC for 1 min and extension at
72oC for 2 min. Set final extension for 10 min at 72oC. Run test PCR product on 1% agarose
gel along with 100bp ladder (1hr at 60 V).
Step 5(d): Bulk Adapter Ligation and PCR
Set up the final adapter ligation based on the results obtained from pilot reactions
above.
RE digested genomic DNA : 10µg (50 µl )

Adapter : Optimized quantity
Ligase buffer (10x) : 15µl
T4 DNA ligase (10U/ µl) : 5µl
Nuclease Free water : to make up to 150µl
Distribute ligation mixture in 3 PCR tubes (50 µl in each tube) and incubate at 160C
overnight in thermocycler. Amplify the ligated products by PCR as detailed below. Set up
eight reactions of 50 µl volume and use the PCR conditions same as used for test PCR.
Ligation mix from above : 8µl

Oligo A (20 picomole) : 2.5µl
PCR Mastermix : 25µl
NFW : 14.5µl (to make up to 50µl)
Step 6: Size Selection
Run bulk PCR product (400µl) on 2% NuSieve GTG (LONZA, USA) agarose gel (7 x 10
cm) using a preparative comb along with 100 bp plus DNA ladder at 60V for 1h and
visualize using a UV-transilluminator. Excise the region containing 400-1000 bp fragments
using a sterilized microscope cover-slip ensuring maximum self protection and minimum
exposure to UV.
Step 7: Elution of Bulk PCR Product from Gel
Extract DNA from agarose gel using Gel Extraction Kit (QIAquick gel extraction kit)
following the supplier’s guidelines. Quantify the eluted DNA using Nanodrop (Thermo
Scientific, USA) and store at -20oC till further use.
Step 8: Probe Designing
Probe is designed based on type of microsatellite to be developed. Available

information regarding the abundance of type of microsatellite can be used for this
purpose. In my case trinucleotide microsatellite marker has to develop. It has been
reported among the tri-nucleotide repeats, AAT, TTG, TAA and TGA are the most abundant
in C. Batrachus accounting for 75.24 % each followed by CTT, GAA, CAT and AAC (4% each).
Remaining six types of tri-nucleotide repeat types (CAC, GCA, CCT, GTG, GCT &TAG) are
found at low level (1.9%; Mohindra et al., 2011). On the basis of above findings following
probes with biotinylation at 3’ end were designed. Hence similar type of review is required
before selection of probe.
Dissolve lyophilized oligo in sterile 1X TE buffer, pH 7.0 to obtain a stock solution of

100pmol/µl (100µM) and store at -20°C.
Sl. No. Probe Sequence 5’-3’ Length Tm

1 (TAT)8 TATTATTATTATTATTATTATTAT 24 480C
2 (TAA)8 TAATAATAATAATAATAATAATAA 24 480C
3 (GTT)8 GTTGTTGTTGTTGTTGTTGTTGTT 24 640C

4 (ACT)8 ACTACTACTACTACTACTACTACT 24 640C
5 (TGA)8 TGATGATGATGATGATGATGATGA 24 640C
Step 9: Enrichment for Microsatellite Containing DNA Fragments
The success of microsatellite marker development is largely governed by this step.

We have initially followed method of Bloor et al. (2001) and Glen et al. (2007) and further
a modified method was developed yielded better result.
Step 9(a): Probe Hybridization with modified protocol
This method is based upon use of probe combination having similar Tm. Four
different combinations :1- (ACT)8& (TGA)8, 2- (ACT)8& (GTT)8, 3-(TGA)8& (GTT)8 and 4-
(TAT)8& (TAA)8 is used.
Prepare a working solution of 10pmoles/µl (10µM) and used directly in the reaction
mixture below.
Adapter ligated DNA : 10 µl

2 Probes (10µM) : 3 µl each
2XHyb solution : 25 µl
PCR grade water : 9 µl
Incubation conditions for probe hybridization are based upon the Tm of the probe
pair. For the first three probe combinations the conditions are - 950C for 15 min; 700C for
30 min; 650Cfor 30 min; 600Cfor 30 min; after which temperature is reduced by 2oC after
every 30 min until it reaches to 440C. Keep mixture for 30 min at this temperature and
then remove for further step. (For the4thprobe combination a similar strategy is followed
only that the minimum temperature used is 400C)
Step 9(b): Preparation of Magnetic Beads (Dynabeads)
Take 50 µl of streptavadin-coated magnetic beads (10mg/ml) (M-280 Dynabeads,

Dynal) in a 1.5 ml sterilize microcentrifuge tube and wash in 250 µl of 1XTE by gentle
pipetting. Place the tube containing mixture on magnetic particle concentrator (MPC)
stand for 3 min until the magnetic beads got accumulated on one side and remove liquid.
Wash thrice with 1X TE buffer and then once with 1XHyb solution and finally suspend in
150 µl 1XHyb.
Step 9(c): Collection of Probe Hybridized DNA Fragment
Spin down the DNA and probe mixture (50µl) from above and add to the 150 µl of
dynabead suspension. Incubate mixture on orbital shaker on slow speed (130 rpm) for 1 h
at r.t. Subsequently, capture the bead using MPC and remove supernatant by pipetting.
Wash dynabeads twice with 400 µl 2XSSC, containing 0.1% SDS. During each washing step
resuspend the beads properly by pipetting with 1 ml micropipette before harvesting. Again
wash the beads twice with 400 µl of 1XSSC/ 0.1%SDS. Perform two final wash with the
same wash buffer warmed to 50oC (within 5-100C of the Tm for the oligo). Finally suspend
the beads in 200 µl 1X TE, vortex and incubate at 950 C for 5 min.
Step 9(d): Collection of DNA from Dynabeads
Place a new 1.5 ml tube in MPC and transfer beads from above to this tube without
delay. From here pipette out supernatant immediately and transfer to a new labelled tube
(~150µl) (This supernatant contain enriched fragments of DNA). To this supernatant add
22µl of NaOAc/EDTA solution and mix by pipetting. Precipitate DNA by adding 500 µl of
95% ethanol. Mix the contents by inverting the tube and then place on ice for 30 min.
Pellet the DNA by centrifugation at 13000 rpm for 12 min. Discard the supernatant and
add 500 µl of chilled 70% ethanol and centrifuge at 13000rpm for 10 min. Carefully take
out supernatant using pipette and place the sample in laminar flow for air drying (around
20 min). Resuspended pellet in 25µl of 1XTE and keep at 40C overnight for rehydration.
Step 10: Amplification of Enriched DNA Fragments
Prepare eight reaction tubes with 50 µl reaction volume as given below.
PCR Mastermix (Fermentas, USA) : 25µl

Oligo A (10pmol) : 3µl
DNA : 5µl
PCR grade water : 17µl (made up to 50µl)
PCR cycling condition - initial denaturation at 95°C for 3 min followed by 5 cycles of
denaturation at 95°C for 30 s, 60oC for 30s and extension at 72°C for 45s, followed by 30
cycles of initial denaturation at 92°C for 30s, 60 °C for 30s and extension at 72°Cfor 55s and
final extension for 30 min at 72oC. Separate PCR product on agarose gel and excise
fragments of 400-1000 bp and eluted using kit. Estimate the concentration of eluted DNA
using Nanodrop spectrometer.
Step 11: T/A Cloning
PCR products amplified by Taq polymerase have an extra single 3'-A overhang to
each strand of the PCR product. This allows these amplicons to be cloned into vectors that
have been specifically designed to carry a ‘T’ overhang on the complementary strand
(called T/A vectors). InsTAclone™ PCR Cloning Kit (Thermo Scientific, USA) can be used for
T/A cloning.
Step 11 (a): Ligation
The insert-vector amount for the ligation is determined by the following formula:
ng of vector × kb size of insert × molar ratio of insert = ng of insert

kb size of vector vector
The approximate molar ratio of the insert and vector is kept as 3:1. Considering the
average insert size to be 0.7 kb the ligation reaction mixture is prepared as following-
Components Volume
Vector (55ng/µl) 3.0 µl
Insert (24 ng/µl) 5.15 µl
Ligation Buffer (10X) 2.0 µl
T4 DNA ligase5 U/µl 1.0 µl
NFW 8.85 µl
Incubate ligation mixture overnight at 160C in PCR and store at -200C till use.
Step 11(b): Transformation
Perform transformation using InsTAclone PCR Cloning kit (Thermo Scientific, USA)
as per the protocol supplied by the manufacturer. Add 150 µl overnight culture (150 µl) to
fresh 1.5 ml pre-warmed (37°) C-medium and incubate at 37°C for 20 min in a shaking
incubator at 160 rpm. The bacterial culture thus obtained is used for transformation.
Prepare T-solution by mixing equal volumes of A-solution with B-solution and keep on ice.
Centrifuge 1.5 ml of E.coli culture at 10,000xg for 1 min. Discard the supernatant and
resuspend the cell pellet in 300 µl of T-solution and incubate the tube on ice for 5 min.
Pellet down the cells at 10000xg for 1 min and discard the supernatant. Re-suspend the
cells in 120 µl of T-solution and incubate on ice for 5 min. Place ligation mixture in ice for 2
min and add 2.5 µl of it to 50 µl of the cells and mix properly and incubate on ice for 5 min.
Finally spread the cells on the pre warmed X-gal-IPTG and Ampicillin added LB agar plates
and incubate overnight at 37°C in an incubator until the appearance of bacterial colonies.
Discard the fully or partially blue colonies. Prepare master plate picking white colonies.
Step 12: Colony PCR of Recombinant Clones
Screen white colonies for the presence of insert using colony PCR. Perform Colony
PCR with M13 universal primers (F: TGTAAAACGACGGCCAGT, R: CAGGAAAC AGCTATGAC).
Pick white colonies individually using flame sterilized inoculation loop and suspend in 20
µl of TE. The PCR reaction mixture comprised of following
2x PCR master mix : 12.5 µl

M13 F& R primers (10 pmoles) : 1 µl each
Colony Suspension : 1 µl
NFW : 9.5 µl
The PCR cycling conditions - initial denaturation at 95°C for 5 min followed by 30
cycles of denaturation at 95°C for 50s, annealing at 55ºC for 30 sec. and extension at 72oC
for 2 min and final extension for 10 min at 72oC. Determine the insert size by running the
PCR product on 1% agarose gel against a molecular size standard.
Step 13: Sequence Analysis
Select clones from which fragments above 600 bp could be amplified and grow on
freshly prepared LB-Amp stab (in 2 ml microfuge tube) and send for sequencing. Analyze the
good quality sequences using three softwares vecscreen (http://www.ncbi.nlm.nih.gov/
tools/vecscreen/), Clustal W (http://www.ebi.ac.uk/ Tools/msa/clustalw2/) and Gene
Runner to remove vector sequences as well as adapter sequences. After this step analyze
the sequences for the presence of microsatellite repeats by using three online software
http://mail.nbfgr.res.in/fishmicrosat/repmap.php,http://wsmartins.net/websat/ and http://
www.biophp.org/minitools/microsatellite_repeats_finder/demo.php.
Step 14: Primer Designing
Select the sequences containing microsatellites loci for designing locus specific
primers. The primers are designed in the repeat flanking regions by using the software
Gene Runner version 3.05. Select primers with minimum secondary structures and high
Tm.
Step 15: Validation of Primers
Amplify specific loci from genomic DNA of C. batrachus using designed primers.
Use touch-down PCR conditions to prevent mispriming. Run PCR products on 1% agarose
gel along with 100bp ladder
Step 16: PCR Amplification of Microsatellites
Perform PCR using genomic DNA using following reaction composition.
10x Buffer with MgCl2 : 2.5 µl

Template (50-100ng) : 1.0 µl
dNTP (200µm) : 2.0 µl
Forward primer (10 pmol) : 1.0 µl
Reverse primer (10 pmol) : 1.0 µl
Taq polymerase (0.75 U) : 0.30 µl
NFW : To make up to 25 µl
Reaction condition- initial denaturation at 94⁰C for 5 min and 35 cycles of

denaturation at 94⁰C for 30s, primer specific touchdown annealing temperatures for 30s
and 1 min at 72⁰C for extension and final extension at 72⁰C for 7 min and hold at 4⁰C.
Step 17: Polyacrylamide Gel Electrophoresis (PAGE)
Separate amplified products by PAGE (polyacrylamide gel electrophoresis) with

10% resolving gel (amplicon size is small). Assemble the PAGE apparatus and seal with 1%
agarose before pouring the gel mixture. Use spacers and combs of 1 mm thickness.
Prepare 30% stock solution of acrylamide and bisacrylamide as shown below and store at
4⁰C in dark bottle until use. Prepare 10% resolving gel. Always prepare fresh ammonium
persulphate solution in nuclease free water.
1. Acrylamide- Bisacrylamide Solution
Acrylamide (30%) : 33.3ml

5X TAE Buffer : 20ml
10% APS (Prepared fresh) : 700µl
TEMED : 35µl
DMW : 46ml (to make up to 100ml)
2. TBE buffer 10X (pH-8.0)
Tris base : 108 g

Boric acid : 55 g
EDTA (0.5M) : 40 ml
Make the volume upto 1000 ml with distilled water autoclave and store at room
temperature.
3. Gel loading buffer
Bromophenol blue : 0.5%
Glycerol (molecular grade) : 30%
Prepare in 1X TBE and store at 40C.

4. 1X TBE buffer
10X TBE : 10ml

Distilled water : 90ml
Pour the 10% acrylamide gel mixture between the plates and insert the comb
carefully to avoid introduction of bubbles. Allow the gel to polymerize for 30 min and then
fill the anodic and cathodic chambers with 1x TAE. Remove the comb gently and load
sample in well. The samples include 15µl of the PCR product and 3µl of 6X loading dye.
Connect the apparatus to a power supply and run under constant voltage conditions at 80
V for 10 -12 h, allowing adequate time for allele separation. Dismantle the apparatus after
run over and keep the gel for staining. Visualize the stained gels on the gel documentation
system.
Step 18: Visualization of microsatellite products by Silver Staining
Fix the gel in 50ml of fixing solution (diluted 10ml of 5X fixing solution in 30ml of
distilled water and 10ml of absolute ethanol) for 30 minutes and silver impregnation with
1X staining solution for another 30 minutes. Then wash the gels in distilled water for 5
minutes, after removing the staining solution. Keep gels in the 1X developing solution in
darkness for 10 minutes. Pour out the developing solution after appearance of dark and
add stopping solution (1X) immediately.
Solution Composition
1. Fixing solution Benzene sulphonic acid; 3.0% w/v in 24% v/v ethanol
2. Staining solution Silver nitrate; 1.0% w/v Benzene sulphonic acid; 0.35%
w/v
3. Developing solution Sodium carbonate, 12.5% w/v, Formaldehyde; 37% w/v in
water Sodium thiosulphate; 2% w/v in water
4. Stopping solution Acetic acid, 5% v/v Sodium acetate, 25% w/v Glycerol;
50% v/v
Step 19: Microsatellite Allele Scoring
Determine the size of bands obtained for specific loci for all the individuals against
the DNA size ladder using software MyImage analysis version1.1 (Thermo scientific).
Identify alleles and assign genotypes to each individual. Make record homozygous and
heterozygous individual.
Step 20: Statistical analysis of data
Estimate the genetic parameters viz., Allele frequencies, Observed and expected
heterozygosity values, genetic differentiation using GenAlex 6.4 (Peakall and Smouse 1996)
software. Calculate polymorphic information content (PIC) value for all loci using Cervus
v.3.0 (Marshall et al., 1998).
References
Bloor, P.A., F, S., Watts, P. C., Noyes, H. A. and Kemp, S, J., 2001. microsatellite library by
enrichment. School of biological of biological sciences, University of Liverpool.
Glenn, T.C. and N.A. Schable., 2005. Isolating microsatellite DNA loci. Methods in
Enzymology, 395:202-222.
Marshall T. C., Slate J., Kruuk L. E. B., Pemberton J. M., 1998. Statistical confidence for
likelihood-based paternity inference in natural populations. Molecular
Ecology 7:639–655
Peakall, R., & Smouse, P. E., 2006. GENALEX 6: genetic analysis in excel. Population genetic
software for teaching and research. Molecular Ecology Notes, 6, 288–295.
Sambrook, J., Fritsch, E.F. and Maniatis, T. 1989. Molecular cloning: a laboratory manual,
2nd ed. ColdSpring Harbour, New York: Cold Spring Harbour Laboratory Press.
Senan, S., Kizhakayil, D., Sasikumar, B., & Sheeja, T. E. 2014. Methods for development of
microsatellite markers: an overview. Notulae Scientia Biologicae, 6(1), 1-13.
Isolation of Plasmid DNA

What is Plasmid DNA?
Plasmids are extra chromosomal molecules of DNA that vary in size from 1 kb to
more than 200 kb. Most of them are double stranded, covalently closed, circular
molecules that can be isolated from bacterial cells in a superhelical form. They behave as
accessory genetic units that replicate and are inherited independently of the bacterial
chromosome. They frequently contain genes coding for enzymes that are advantageous
to the bacterial host. These genes specify a remarkably diverse set of traits many of
which are of great commercial significance. Among the phenotypes conferred by
plasmids are resistance to and production of antibiotics, or degradation of complex
organic molecules, etc.
Principle
Alkaline lysis in combination with the detergent SDS has been used for more than
20 years to isolate plasmid DNA from E. coli. Exposure of bacterial suspensions to
strongly anionic detergent at high pH opens the cell wall, denatures chromosomal DNA
and proteins and releases plasmid DNA into the supernatant. Although the alkaline
solution completely disrupts base pairing, the strands of closed circular plasmid DNA are
unable to separate from each other because they are topologically intertwined. As long
as the intensity and duration of exposure to OH- is not too great the two strands of
plasmid DNA fall once again into register when the pH is returned to neutral.
During lysis bacterial proteins, broken cell walls and denatured chromosomal
DNA become enmeshed in large complexes that are coated with dodecyl sulphate. These
complexes are efficiently precipitated from solution when sodium ions are replaced by
potassium ions. After denatured material has been removed by centrifugation, native
plasmid DNA can be recovered from the supernatant.
Reagents Required:
Lysis buffer I (P I)
0.5 M EDTA (pH 8.0) 1ml

1M Tris (pH 8.0) 1.25 ml
Dextran 0.045g
Make up the volume to 50 ml with distilled water. Autoclave at 121oC and 15 lb pressure
for 20 min.
Lysis buffer II (P II)
10N NaoH 0.2ml

10%SDS 1ml
Make up volume to 10 ml with sterile distilled water. P II has to be prepared fresh.
Lysis Buffer III (P III)
5 M potassium acetate 60 ml
Glacial acetic acid 0.5 ml
dH20 23.5 ml
The resultant solution is 3M with respect to potassium and 5M with respect to acetate.
Protocol
1. Set up 1ml cultures of clones from the master plate in LB/ampicillin media and
incubate overnight at 37C with vigorous shaking in a shaking incubator.
2. Harvest cells by centrifuging at 6000 rpm for 5 min.
3. Resuspend cell pellet in 100µl of lysis buffer I.
4. Vortex to suspend the cells.
Tip Ensure that bacteria are resuspended completely leaving no cell clumps in order to
maximize the number of cells exposed to the lysis reagents.
5. Keep it in the ice for 20 minutes.
6. Add 200µl of lysis buffer II.
7. Mix by inverting the tube several times and incubate on ice for 5 minutes.
Tip Avoid vigorous stirring or vortexing of the lysate as this can shear the bacterial
chromosome, which will then copurify with the plasmid DNA.
Tip Do not allow the lysis to proceed for longer than 5 minutes. This is optimal for
release of the plasmid DNA, while avoiding irreversible plasmid denaturation.
8. Add 150µl of chilled lysis buffer III.
9. Mix it by vortexing.
10. Incubate it on the ice for 20 minutes.
11. Centrifuge at 12000 rpm for 15 minutes.
12. Transfer the supernatant to fresh tube.
13. To this add 0.6 volumes of isopropanol.
Tip Use all solutions at room temperature to minimize co-precipitation of salt.
14. Precipitate the plasmid by mixing.
15. Incubate in the ice for 10-15 minutes.
16. Centrifuge at 12000 rpm for 10 min.
Tip Care should be taken when removing the supernatant as pellets from isopropanol
precipitation are more loosely attached to the side of the tube.
17. Wash the pellet with 70% alcohol.
18. Allow the pellet to dry at room temperature, or by vacuum drier for 5 minutes.
19. Resuspend the pellet in 25l TE and store it at 4oC.
Tip Choose an appropriate volume of buffer according to the expected DNA yield and
the desired final DNA concentration.
Tip Use a buffer with a pH ≥8.0 for redissolving, as DNA does not dissolve easily in
acidic buffers. (If using water, check pH).
20. Check the DNA by running in 1% agarose gel.
Treatment of plasmid DNA by RNase A
Since the plasmid prep also has RNA it is important to remove it as it might
obscure the insert fragments released from digested recombinant plasmids during
screening. Follow the steps given below.
1. 1µl RNase is added to each plasmid prep.
2. Incubate in water bath at 37oC for one hour.
3. Check on 1% agarose gel.
Recombinant DNA Technology

Construction of a genomic DNA library is a cloning strategy that involves the
insertion of random fragments of a large DNA molecule into a vector, resulting in a large
number of different recombinant DNA molecules. By this procedure one can make a
clone library representing all or most of the genes present in the cell.
Cloning serves two main purposes. First, it allows a large number of recombinant
DNA (rDNA) molecules to be produced from a limited amount of starting material. At the
outset only a few nanograms of rDNA may be available, but each bacterium that takes
up a plasmid subsequently divides numerous times to produce a colony, each cell of
which contains multiple copies of the molecule. In this way cloning can supply the large
amounts of DNA needed for molecular biological studies of gene structure and
expression.
Another use is that the genomic libraries retained for many years, and
propagated so that copies can be sent from one research group to another.
The basic steps in gene cloning experiment are as follows:
 A fragment of DNA, containing the gene to be cloned, is inserted into a circular

DNA molecule called a vector, to produce a chimera or recombinant DNA
molecules.
 The vector acts as a vehicle that transports the gene into a host cell, which is
usually a bacterium, although other type of living cell can be used.
 Within the host cell the vector multiplies, producing numerous identical copies
not only of itself but also of the gene that it carries.
 When the host cell divides, copies pf recombinant DNA molecules are passed to
the progeny and further vector replication takes place.
 After large number of cell division, a colony, or clone, of identical host cells is
produced. Each cell in the clone contains one or more copies of the recombinant
DNA molecules; the gene carried by the recombinant molecule is now said to be
cloned.
Cloning in plasmid vectors
In principle, cloning in plasmid vectors is very straightforward. Closed circular

plasmid DNA (Fig. 1) is cleaved with one or more restriction enzymes and ligated in vitro
to foreign DNA bearing compatible termini. The products of ligation reaction are then
used to transform an appropriate strain of E. coli. The resulting transformed colonies are
screened by hybridization, by PCR or by digestion with restriction enzymes to identify
those that carry the desired DNA sequences.
The following considerations are of importance before undertaking such cloning-
 The choice of plasmid vector suitable for the task at hand
 The choice of restriction sites within vector
 The optimal condition for the ligation reaction
 The strain of E. coli best suited to propagate a plasmid carrying the foreign DNA
of interest
 The method used to screen transformants and the techniques used to validate
clones of interest
 Whether special steps are required to decrease the background of transformed

colonies that contain "empty" parental plasmid
 The controls that are necessary at each stage
Fig. 1. A plasmid expression vector. pQE 30, 31 and 32 are a series of vectors that
compensate for the frameshift mutation arising from restriction digestion of
DNA to be cloned.
Choice of restriction endonucleases
Gene cloning requires that DNA molecules be cut in a very precise and
reproducible fashion. This is illustrated by the way in which the vector is cut during
construction of a recombinant DNA molecule. Each vector molecule must be cleaved at a
single position to open up the circle so that new DNA can be inserted; a molecule that is
cut more than once will be broken into two or more separate fragments and will be of
no use as a cloning vehicle. Furthermore, each vector molecule must be cut at exactly
the same position on the circle, random cleavage is not satisfactory. It should be clear
that a very special type of nuclease is needed to carry out this manipulation.
In particular enzymes termed type II restriction endonucleases have been found

to play a key role in all aspects of molecular biology. These enzymes recognize certain
DNA sequences, usually 4-6 bp in length, and cleave them in a defined manner. The
sequences recognized are mostly palindromic
5' GGCC 3'

3' CCGG 5'
or of an inverted repeat nature
5' AGAACAnnnTGTTCT 3'
3' TCTTGTnnnACAAGA 5'
that is, they read the same in both directions on each strand (Fig 2). When cleaved they
leave a flash ended or staggered (also termed a cohesive-ended) fragment depending on
the particular enzyme used (Glick, B.R. and Pasternak, J.J. 1989).
Fig. 2. RE recognition sites and types of ends produced
The number of recognition sequences for a particular RE in a DNA molecule of

known length can be calculated mathematically. A tetranucleotide sequence (e.g. GATC)
should occur once every 44=256 nucleotides, and a hexanucleotoide (e.g. GGATCC) once
every 46=4096 nucleotides. These calculations assume that the nucleotides are ordered
in a random fashion and that the four different nucleotides are present in equal
proportion. Although mathematics may give an idea of how many restriction sites to
expect in a given DNA molecules, only experimental analysis can provide the true
picture.
Ligation - joining DNA molecules together
The first step in construction of recombinant DNA molecules is the joining

together of the vector molecule and the DNA to be cloned. This process is referred to as
ligation, and the enzyme that catalyses the reaction is called DNA ligase (Fig. 3).
Fig. 3. Ligation of DNA fragments
All living cell produce DNA ligase, but the enzyme used in genetic engineering is
usually purified from E. coli bacteria that have been infected with T4 phage. Within the
cell the enzyme carries out the very important function of repairing any discontinuities
that may arise in one of the strands of a double stranded molecules. A discontinuity is
simply a position where a phosphodiester bond between adjacent nucleotides is
missing. Although discontinuities may arise by chance breakage of the cell’s DNA
molecules, they are also a natural result of processes such as DNA replication and
recombination. Ligases therefore play several vital roles in the cell.
Ligation of complementary sticky ends is efficient. This is because compatible

sticky ends can base pair with one another by hydrogen bonding, forming a relatively
stable structure for the enzyme to work on. If the phosphodiester bonds are not
synthesized fairly quickly the sticky ends will fall apart again. This transient, base–paired
structure do, however, increase the efficiency of ligation by increasing the length of time
the ends are in contact with one another.
Introduction of DNA into E. coli (Sambrook et al., 2001)
After ligation, ligated molecules should be transformed into living E. coli cells. In the
ligation mixture may contain, in addition to the desired recombinant molecule, any
number of the following:
1. Unligated vector molecules
2. Unligated DNA fragments
3. Vector molecules that have re-circularized without new DNA being inserted
(‘self-ligated ‘vector)
4. Recombinant DNA molecules that carry the wrong inserted DNA fragment.
Preparation and transformation of competent E. coli
Nucleic acids do not enter bacteria by themselves, but require assistance in

traversing the outer and inner cell membranes and in reaching an intracellular site
where they can be expressed and replicated. The methods that have been devised to
achieve these goals fall into two classes: chemical and physical.
A. Chemical methods
Most of the chemical methods currently used for bacterial transformation are
based on the observation of Mandel and Higa (1970), who showed that bacteria treated
with ice-cold solution of CaCl2 and then briefly heated to 370C to 420C could be
transfected with bacteriophage λDNA. The same method was subsequently used to
transform bacteria with plasmid DNA (Cohen et.al. 1972) and E. coli chromosomal DNA
(Oishi and Cosloy 1972).
Why this treatment works is not understood. Possibly CaCl2 cause the DNA to
precipitate onto the outside of the cells, or perhaps the salt is responsible for same kind
of change in the cell wall that improves DNA binding. In any case, soaking in CaCl2 affects
only DNA added to treated cells; it remains attached to the cell exterior, and is not at
this stage transported into the cytoplasm. The actual movement of DNA into competent
cells is stimulated by briefly raising the temperature to 420C. Once again, the exact
reason why this heat shock is effective is not understood.
B. Physical methods
Exposure to an electrical charge destabilizes the membranes of E. coli and

induces the formation of transient membrane pores through which DNA molecules can
pass (Neumann and Rosenheck, 1972). This method, which is known as electroporation,
was subsequently developed to introduce DNA into eukaryotic cells (Neumann et. al.,
1982) and was subsequently adapted for transformation of E. coli (Dower et. al. 1988;
Taketo, 1988) and other bacteria by plasmid (Miller et. al.1988). It is the easiest, fastest,
most efficient, and most reproducible methods for transformation of bacterial cells with
DNA.
Unlike chemical transformation, the number of transformants generated by

electroporation is marker-dependent. For example, when pBR322, which carries genes
conferring resistance to two antibiotics (ampicillin and tetracycline), is introduced into E.
coli by electroporation, the number of tetracycline – resistant transformants is ~100 fold
less than the number of ampicillin resistant transformants (Steele et. al., 1994). This
effect is not seen when the plasmid is introduced into the bacteria by chemical
transformations. A likely explanation is that damage or depolarization caused by pulse of
electrical current prevents or delays insertion into the inner cell membrane of the
antiporter protein responsible for tetracycline resistance.
Selection for transformed cells

Antibiotic resistance
All plasmids carry a selectable marker, which is simply a gene that provides a
transformed cell with a new characteristic, one that is not possessed by a non-
transformant. Most plasmid cloning vectors carry at least one gene that confers
antibiotic resistance on the host cells, with selection of transformants being achieved by
plating onto an agar medium that contains the relevant antibiotic.
Blue/white selection
After a brief incubation following transformation to allow expression of the

antibiotic resistance genes, the cells are plated onto medium containing an antibiotic,
for example ampicillin. Colonies that grow on these plates must be derived from cells
containing plasmid, since this carries the gene for resistance to ampicillin. It is not, at
this stage, possible to distinguish between those colonies containing plasmid with
inserts and those which simply contain recircularised plasmids. To do this, the colonies
are selected through blue/white selection.
The most popular restriction sites are constructed into a region termed the
multiple cloning site (MCS). The MCS in a blue/white selection enabled vector is included
in a gene that codes for a portion of a polypeptide called -galactosidase. When the
plasmid has been used to transform the host cell E. coli, the gene may be switched on by
adding the inducer IPTG. Its presence causes the enzyme -galactosidase to be
produced. The functional enzyme is able to hydrolyse a colorless substance called X-gal
to a blue insoluble material. However, if the gene is disrupted by the insertion of a
foreign fragment of DNA, a non functional enzyme results that is unable to carry out
hydrolysis of X-gal. Thus, the colony transformed with the recombinant plasmid will be
white in the presence of X-gal, whereas the colony transformed with an empty vector
will be blue, since its gene is fully functional and not disrupted. This elegant system is
termed blue/white selection.
References
- Sambrook J., Fritsch, E.F.and Miniatis, T., 2001. Plasmids and Their Usefulness in
Molecular Cloning, Molecular cloning: a laboratory manual, 3rd ed. Cold Spring
Harbor Laboratory, New York, vol.1: 1.1-1.138.
- Brown, T.A.2001. Gene cloning and analysis: An Introduction 4th ed. Blackwell
Scientific publications, Oxford, United Kingdom
- Cohen S.N., Chang A.C.Y., and Hsu L.1972. Nonchromosomal antibiotic resistance
in bacteria: Genetic transformation of Escherichia coli by R-factor DNA. Proc.
Natl. Acad. Sci. 69: 2110-2114.
- Dower, W.J., Miller J.F. and Ragsdale C.W., 1988. High efficiency transformation
of E.coli by high voltage electroporation. Nucleic Acids Res. 16:6127-6145
- Glick, B.R. and Pasternak, J.J. 1989. Molecular Biotechnology; principle and
applications of recombinant DNA, 2nd ed. ASM press. Washington D.C pp23-36.
- Neumann E., and Rosenheck K. 1972. Permeability changes induced by electric

impulse in vesicular membranes. J. Membr. Biol. 10: 279-290.
Strategies for Cloning a DNA Fragment

Most cloning experiments involve the insertion of a DNA fragment (generally
termed, insert) into a plasmid (termed, vector) for downstream protein expression,
insertion of a multiple cloning site or the addition of a property to the vector (e.g., a
drug resistance marker, a promoter, a signal sequence, etc.). There are several ways of
preparing either insert or vector based on the source and purpose of cloning. The
following tips will help with the design and troubleshooting of cloning.
I. Cloning of PCR amplified fragments
It is often required to clone a PCR amplified DNA fragment between selected RE

sites in the multiple cloning site (mcs) of a vector. The fragment could be cloned in a
single RE site or between two different RE sites. There can be two conditions: (i) the
sequence of the fragment to be inserted is known, and (ii) the sequence is unknown.
1. Sequence of the insert is known
(i) Use of linker primers
In the first condition, it is possible to screen the sequence for the presence or
absence of RE sites and only those RE sites that are present in the mcs of the vector but
absent in the insert are selected. The recognition sequences of these REs could be added
to the primers as extensions on the 5’ end. An additional triple A sequence precedes the
RE sequence at the 5’ end to allow enzyme attachment during RE digestion.
E.g. : 5’ AAAGCTAGCTGCAGGAGACGAAGTACGGC
Often the sequence is a gene that one intends to express from a promoter of
one’s own choice. Various expression vectors offer a choice of promoters and while
cloning in these vectors it is important to ensure that the promoter is located at the 5’
end of the insert. Hence, one needs to take note of the position of RE sites in the mcs to
decide which site is to be added to the forward primer and which to the reverse. E.g. if
in the following mcs
5’-Promoter – BamHI – NheI – XhoI- EcoRV – HindIII – 3’
the sequence is to be cloned between NheI and EcoRV sites then the forward primer will
contain the NheI site and the reverse will contain the EcoRV. Such cloning is called
directional cloning. Since the overhangs produced on digesting the vector by two
different enzymes are not complementary (unless the enzymes produce complementary
DBT-HRD National Training in Molecular Biology & Biotechnology, CIFE, Mumbai 296
ends, eg., NheI and XbaI) there is no possibility of the vector re-circularizing without the
insert. This is another advantage of directional cloning. For digesting with two enzymes
one could set up a double digest or a sequential digest as detailed in the chapter
Restriction Endonuclease Digestion.
If for some reason cloning is to be done in a single site (as when all other mcs
sites are present in the fragment) then re-circularization of the vector is to be
prevented by cleaving the free phosphate group at the 5’ ends of the vector by treating
the digested vector with Calf intestinal Alkaline Phosphatase (CIAP) as given below.
Linear DNA : 1µg (1 pmol termini)

10X buffer : 2 µl
CIAP : 1 µl (1 u)
dH20 : made to 20 µl
Mix thoroughly, spin briefly and incubate at 37oC for 30 min. Stop reaction by
heating at 85oC for 15 min.
In this case there is a possibility of the fragment being inserted in either

orientation and the clone with the correct orientation with respect to the promoter will
have to be determined. This is done by digesting selected clones with two enzymes such
that differently sized fragments are generated for the two orientations enabling
identification of the correct one as shown in the following figure.
Hind III
Eco RI
Pro 5’ 3’
250 bp fragment
Correct orientation
Hind III
Eco RI
Pro 3’ 5’
800 bp fragment
Incorrect orientation
(ii) Attachment of adaptors to amplified fragments
If all the enzymes of the mcs are present in the insert one could opt for the
attachment of adaptors to the PCR amplified fragment. Adapters are pre-cleaved
restriction enzyme sites chemically synthesized in vitro that can be readily annealed to
the ends of the PCR product. These adapter ligated DNA fragments have protruding 5´ or
3´ overhangs for ligation into a vector digested with appropriate restriction enzymes to
create compatible ends between insert and the vector DNA. Since this strategy does not
require digestion of the insert DNA to create sticky ends, it is a safe method to clone any
DNA fragment for which sequence information is not available to find out whether the
restriction sites of our interest are present or not. Therefore, this strategy is being used
for the preparation of cDNA libraries.
Adapter blunt end of the insert
AATTGGCCGC NNNNN
CCGGCG NNNNN
After ligation
AATTGGCCGCNNNNN
CCGGCGNNNNN
(Pre-cleaved overhang)
2. Sequence of the insert is unknown
(i) T/A cloning
In this case there is no way of knowing which RE sites are present in the fragment
to be inserted. One could opt for T/A cloning of the PCR amplified fragment (see chapter
on T/A cloning) followed by sequencing. Once the sequence is available the above
methodology can be followed.
II. Cut and Paste
It may be required to excise a fragment cloned in one plasmid and transfer it into
the mcs of another vector. This could be easily accomplished if the same pair of enzymes
can be used for digesting both the vector and insert.
If not, one could explore the possibility of using at least one RE that produces
blunt ends. One cohesive and one blunt site can be directionally ligated into a matching
cohesive and mis-matched blunt site. The only fallout is that the recombinant will not be
digestible by both the blunt enzymes as the site is lost. Also, if different blunt sites are to
be used for cloning, the digested vector should be dephosphorylated and the orientation
of the insert should be checked using the RE strategy discussed elsewhere. If only REs
that produce cohesive ends that are not compatible in both vector and insert are
available, the overhangs can be either end filled or chewed up to create blunt ends using
Klenow fragment or T4 DNA polymerase.
(I) NNNNNG GCGCCNNNNNN

NNNNNCCGCG GNNNNNN
...would be filled in using Klenow fragment or T4 DNA polymerase to yield:
NNNNNGGCGC GCGCCNNNNNN
NNNNNCCGCG CGCGGNNNNNN
(Blunt ends)
Protocol for Filling-in Recessed 3'-termini of Double-stranded DNA
Digested DNA : 0.1-4µg

10X reaction buffer : 2µl
2mM dNTP mix : 0.5µl (0.05mM - final concentration),
Klenow fragment : 1-5u,
deionized water : up to 20µl.
Incubate the mixture at 37°C for 10 minutes. Stop the reaction by heating at 70°C for 10
minutes.
(II) NNNNNGGCGC CNNNNNN

NNNNNC CGCGGNNNNNN
...would be subject to the 3'-5' exonuclease digestion, leaving:
NNNNNG CNNNNNN
NNNNNC GNNNNNN
(Blunt ends)
Having modified the DNA ends using the above mentioned strategies, all are now
mutually compatible, and would be compatible with other blunt ends. Note that where
modifications have taken place, the enzyme site is generally destroyed upon relegation
and often a new site would be created.
T/A cloning of PCR Products

Cloning serves two main purposes. First, it allows a large number of recombinant
DNA (rDNA) molecules to be produced from a limited amount of starting material. At the
outset, only a few nanograms of rDNA may be available, but each bacterium that takes
up a plasmid subsequently divides numerous times to produce a colony, each cell of
which contains multiple copies of the molecule. In this way cloning can supply the large
amounts of DNA needed for molecular biological studies of gene structure and
expression.
The T/A cloning procedure provide direct one step cloning of PCR amplified DNA
fragments. DNA polymerase, that is lacking 3’→5’ exonuclease ac vity(proof reading),
possess deoxynucleotidyl transferase (TdT) activity in addition to primer extension
activity, which frequently results in the addition of extra adenines at 3’ends of amplified
DNA molecules. This single 3’adenosyl extension generated by Taq DNA polymerase
provides a highly efficient method to clone PCR products into a vector (T vector)
containing a complementary unpaired 3’thymidyl residue. It should be noted that the 3’-
end extension activity of Taq DNA polymerase is nucleotide specific with respect to the
last 3’- end nucleotide.
Structure of the 3’- ends of PCR products generated by Taq DNA polymerase
5’- end nucleotide of 3’-end nucleotide of product on

Primer complementary strand
A T -T,+A
C G +G>+A>+C
G C +A>+C
T A (+A) at a low efficiency
+ addition of extra nucleotide (3’overhang)

- deletion of the complementary nucleotide (3’recession)
The T/A cloning technique is especially suitable for cloning of PCR fragments
amplified with primers that carry dG or dC at their 5’ ends. “T” vectors can be purchased
ready-made from many commercial suppliers as components of cloning kits (pTZ57R/T
from Fermentas). PTZ57R/T vector has been pre–cleaved with Eco321 (an isoschizomer
of EcoRV) and treated with terminal deoxynucleotidyl transferase to create 3’ddT
overhangs at both ends. When a PCR fragment with 3’- dA overhangs is ligated into the
vector, a circular molecule with two nicks is produced. The circular product can be used
directly to transform E.coli cells with high efficiency. An additional advantage of this
approach is that the T- overhangs prevent re circularization of the vector during the
ligation procedure. As a result, the yields of the recombinants are typically as high as
90%. The DNA can be readily excised from the versatile polylinker of pTZ57R/T and sub
cloned into other vectors, as well as sequenced using standard M13/pUC primers.
Reagents required
1. Vector pTZ57R/T
2. PCR product
3. 5x Ligation Buffer
4. T4 DNA Ligase
5. Water (Nuclease free)
Protocol
Ligation
The efficiency of ligation is known to depend greatly on the purity of PCR

fragments. If the PCR product is sufficiently clean (a homogenous band of desired size is
observed on the gel), it can be directly used in the ligation reaction. The efficiency of
ligation also depends on the amount of added nucleotides to the 3’ ends of the PCR
products. It is recommended that a final long extension step (20-30 mins) at 72oC will
result in an increased amount of the PCR product with the extra nucleotides added.
Another factor affecting the efficiency of ligation and subsequent clone selection is the
vector/insert ratio in the ligation reaction; the optimum molar ratio of the ends appears
to be around 1:3, respectively. The amount of DNA insert required for the efficient
ligation with 0.15μg (0.18 pmol ends) of the vector can be approximately determined
from the following table.
Length of DNA Pico moles of ends Quantity of PCR fragments for ligation
Fragment Per 1μg of DNA reaction in μg (0.54 pmol)
100 30 0.018
300 10 0.054
500 3.0 0.09
1000 3.0 0.18
2000 1.5 0.36
3000 1.0 0.54
1. Dissolve the purified PCR fragment in 10-20μl of TE buffer, determine the

approximate DNA concentration by agarose gel electrophoresis and visual
comparison to a known amount of DNA size markers.
2. Determine the amount of PCR fragment equivalent to 0.54 pmoles of ends by
referring the above table.
3. Add the following components into a 1.5ml microfuge tube
Vector 3μl
Purified PCR fragment 4μl
(approx. 0.54 pmoles)
5x Ligation Buffer 6μl
T4 DNA ligase (5U) 1μl
Water, nuclease free 29μl
4. Incubate at 16oC for overnight.
The products of ligation reaction are then used to transform an appropriate

strain of E. coli. The resulting transformed colonies are screened by hybridization, by PCR
or by digestion with restriction enzymes to identify those that carry the desired DNA
sequences.
Restriction Endonuclease Digestion

Restriction enzymes were discovered 40 years ago during investigations into the
phenomenon of host-specific restriction and modification of bacterial viruses.
Restriction enzymes protect bacteria from infections by viruses, and it is generally
accepted that this is their role in nature. They function as microbial immune systems.
These enzymes were found to cleave DNA at specific sites, generating discrete, gene-size
fragments that could be re-joined in the laboratory. Researchers were quick to recognize
that restriction enzymes provided them with a remarkable new tool for investigating
gene organization, function and expression.
Restriction enzymes are traditionally classified into four types on the basis of
subunit composition, cleavage position, sequence specificity and cofactor requirements.
However, Type II restriction enzymes which cleave the DNA within the recognition
sequence are commonly used for recombinant DNA technology. Although the length of
the recognition sequence varies from one restriction enzyme to other, most of the
commonly used enzymes recognize a 6 bp sequence.
Optimizing Restriction Endonuclease Reactions
There are several key factors to consider when setting up a restriction

endonuclease digest. Using the proper amounts of DNA, enzyme and buffer components
in the correct reaction volume will allow you to achieve optimal digestion. By definition,
1 unit of restriction enzyme will completely digest 1 µg of substrate DNA in a 50 µl
reaction in 60 minutes. This enzyme : DNA : reaction volume ratio can be used as a guide
when designing reactions.
A "Typical" Restriction Digest
However, a general rule is that 10 units of restriction enzyme is sufficient to

overcome variability in DNA source, quantity and purity. Generally, 1 µl of enzyme is
added to 1 ug of purified DNA in a final volume of 50 µl of the appropriate 1X buffer
followed by incubation for 1 hour at the recommended temperature. If an excess of
enzyme is used, the length of incubation can often be decreased to save time.
Alternatively, one can productively digest with fewer units of enzyme for up to 16 hours
with many restriction enzymes.
Restriction Enzyme 10 units is sufficient, generally 1µl is used

DNA 1 µg
10X Buffer 5 µl (1X)
BSA Add to a final concentration of 100 µg/ml (1X) if necessary

Total Reaction Volume 50 µl
Incubation Time 1 hour*
Incubation Temperature Enzyme dependent
* Can be decreased or increased based on the amount of enzyme used.
Important guidelines for handling

Enzyme
 Storage at -20°C is recommended for most restriction enzymes.
 10X NEBuffers and concentrated BSA should also be stored at -20°C
 Keep on ice when not in the freezer
 Exposure to temperatures above -20°C should be minimized whenever possible
 Should be the last component added to the reaction
 Mix components prior to addition of enzyme by pipetting the reaction mixture up
and down, or by "flicking" the reaction tube. Follow with a quick ("touch") spin-
down in a microcentrifuge. Do not vortex the reaction
 Supercoiled plasmids and agarose-embedded DNAs generally require more than
1 unit/µg to be cleaved completely.
DNA
 Should be free of contaminants such as phenol, chloroform, alcohol, EDTA,
detergents or excessive salts
 Methylation of DNA can inhibit digestion with certain enzymes.
Reaction Buffer
 Use at a 1X concentration
 If required, add BSA to a final concentration of 100 µg/ml (1:100 dilution)
 Restriction enzymes that do not require BSA for optimal activity are not
adversely affected if BSA is present in the reaction
Reaction Volume
 A 50 µl reaction volume is recommended for digestion of 1 µg of substrate

 Keep glycerol concentration at less than 5% of total reaction volume to prevent
star activity
 The restriction enzyme (supplied in 50% glycerol) should not exceed 10% of the
total rxn volume
 Additives in the restriction enzyme storage buffer (e.g., glycerol, salt) as well as
contaminants found in the substrate solution (e.g., salt, EDTA, or alcohol) can be
problematic in smaller reaction volumes. The following guidelines can be used
for techniques that require smaller reaction volumes.
Alternative Volumes for Restriction Digests
Reaction
Restriction Enzyme DNA 10X Buffer 100X BSA (if needed)
Volume
10 µl rnx* 1 unit 0.1 µg 1 µl 0.1 µl
25 µl rnx 5 units 0.5 µg 2.5 µl 0.25 µl
50 µl rnx 10 units 1 µg 5 µl 0.5 µl
* 10 µl rxns should not be incubated for longer than 1 hour to avoid evaporation.
Incubation time
 Typically 1 hour
 Can be decreased or increased based on the amount of enzyme used
 It is possible, with many enzymes, to use fewer units and digest for up to 16
hours.
Stopping a Reaction
If no further manipulation of DNA is required:

 Terminate with a stop solution (10 µl per 50 µl rxn) [50% glycerol, 50 mM EDTA
(pH 8.0), and 0.05% bromophenol blue]
When further manipulation of DNA is required:
 Heat inactivation can be used
 Remove enzyme by using a spin column or phenol/chloroform extraction
Control Reactions
If you are having difficulty cleaving your DNA substrate, the following control reactions
can be performed:
 Experimental DNA without restriction enzyme to check for contamination in the
DNA preparation or reaction buffer
 Control DNA (DNA with multiple known sites for the enzyme, e.g. lambda or
adenovirus-2 DNA) with restriction enzyme to test enzyme viability
 If the control DNA is cleaved and the experimental DNA resists cleavage, the two
DNAs can be mixed to determine if an inhibitor is present in the experimental
sample. If an inhibitor (often salt, EDTA or phenol) is present, the control DNA
will not cut after mixing.
Note: Some enzymes have a high DNA binding affinity and may not dissociate from the
product well. This can result in smearing on an agarose gel. In these cases, after the
reaction is complete, add SDS to a final concentration of 0.1-0.5%. This may result in a
cleaner banding pattern.
Double Digests
Digesting a DNA substrate with two restriction endonucleases simultaneously

(double digestion) is a common timesaving procedure. Selecting the best buffer to
provide reaction conditions that optimize enzyme activity as well as avoid star activity
associated with some enzymes is an important consideration. Each enzyme is supplied
with its optimal buffer to ensure 100% activity. Refer to the activity chart provided by
the supplier for the percentage activity of each restriction endonuclease in the standard
buffers to select a buffer that is optimal for both the enzymes.
Setting up a Double Digestion

 Choose a buffer that result in the most activity for both enzymes.
 If BSA is required for either of the enzyme, add it to the double digest reaction
(BSA does not inhibit any restriction enzyme).
 Set up reaction according to recommended conditions.
 Overnight double digests should be avoided due to the possibility of star activity.
 If two different incubation temperatures are necessary, choose the optimal
reaction buffer and set up reaction accordingly. Add the first enzyme and
incubate at the desired temperature, then, heat kill the first enzyme, add the
second enzyme and incubate at the recommended temperature.
 Depending on an enzyme's activity rating in a non-optimal buffer, the number of
units or incubation time may be adjusted to compensate for the slower rate of
cleavage.
Setting up a Sequential Digestion

 Set up a reaction using the restriction endonuclease that has the lowest salt
concentration in its recommended buffer and incubate to completion.
 Adjust the salt concentration of the reaction (using a small volume of a
concentrated salt solution) to approximate the reaction conditions of the second
restriction endonuclease.
 Add the second enzyme and incubate to complete the second reaction.
 Alternatively, a spin column can be used to isolate the DNA prior to the second
reaction.
Preparation of Competent Cells
Competent Cells
Since DNA is a very hydrophilic molecule, it won't normally pass through a

bacterial cell's membrane. In order to make bacteria take in the plasmid, they must first
be made "competent" to take up DNA. This is done by creating small holes in the
bacterial cells by suspending them in a solution with a high concentration of calcium.
DNA can then be forced into the cells by incubating the cells and the DNA together on
ice, placing them briefly at 42oC (heat shock), and then putting them back on ice. This
causes the bacteria to take in the DNA. The cells are then plated out on antibiotic
containing media.
Competency
The procedure to prepare competent cells can sometimes be tricky. Bacteria

aren't very stable when they have holes put in them, and they die easily. A poorly
performed procedure can result in cells that aren't very competent to take up DNA. A
well- performed procedure will result in very competent cells. The competency of a
stock of competent cells is determined by calculating how many E. coli colonies are
produced per microgram (10 -6 grams) of DNA added. An excellent preparation of
competent cells will give ~108 colonies per ug. A poor preparation will be about 10 4 / ug
or less. Our preps should be in the range of 10 5 to 10 6.
Competent cells are generally prepared from log phase E. coli (DH5α) cells by
treating with 0.1M ice cold calcium chloride as described by Sambrook, et al. (2001).
Reagents required
1. Calcium Chloride (0.1 M)

2. Log phase cells
Note
This procedure must be performed under sterile conditions. Use only autoclaved plastic-
ware and always work with a flame in front of you. Also, bacteria are very labile in high
calcium, so keep the bacteria on ice and away from the flame at all times to keep them
viable.
Protocol
1. Inoculate a 5 ml LB broth with E. coli DH5α strain using a sterile inoculation loop.
2. Incubate the culture at 37°C overnight in an orbital shaker with vigorous shaking.
3. The next morning, inoculate 5 ml fresh LB broth with 50 µl overnight grown culture
and incubate at 37°C with vigorous shaking for 6 h to obtain the cells in log phase.
4. After 6 h, harvest the log phase cells by centrifugation at 6000 xg for 5 min.
5. Wash the cell pellet twice with chilled 0.1 M CaCl2.
6. Suspend the cell pellet was in 0.5 ml of the chilled 0.1 M CaCl2 and incubate on ice
for 20 min.
7. Pellet the cells at 6000 x g for 5 min and discard the supernatant.
8. Resuspend the cell pellet in 0.5 ml of 0.1 M CaCl2 and keep on ice overnight.
9. The cells can be either used for transformation the next day or treated for long term
storage at -70°C using the following protocol (Sambrook, et al., 2001).
10. To every 4 ml of resuspended cells, add 140 µl of DMSO, mix gently by swirling, and
incubate the tubes on ice for 15 min.
11. Add an additional 140 µl of DMSO to the cell suspension, mix gently by swirling and
then return the tube to the ice bath.
12. Working quickly, dispense 100 µl aliquots into chilled, sterile microfuge tubes and
snap-freeze immediately by immersing in liquid nitrogen and stored at -70oC.
Transformation and selection of recombinants
Transformation and Selection of Recombinants
The purpose of transformation is to introduce a foreign plasmid into bacteria and

to use those bacteria to amplify the plasmid in order to make large quantities of it.
Transformation involves taking up of ligated DNA by competent cells during a brief
increase in temperature termed ‘heat shock’. Small circular molecules are taken up most
efficiently, whereas long linear molecules do not enter the cells (Sambrook, et al., 2001).
Reagents required
1. 100 µl aliquot of DH5α competent cells

2. Ligation reaction mixture
3. LB broth
Protocol
1. In a sterile 0.5 ml eppendorf tube, add 5 l of ligation mix and keep on ice.
2. Then add 100 µl of DH5α competent cells and incubate the tube on ice for 20 min.
3. After 20 min, keep the tube at 43.5°C for 55 sec in a dry bath for a brief heat shock
and immediately chilled.
4. 1 ml of sterilized LB broth was added and the cells were revived by incubation at
37°C for 1 hr in an orbital shaker.
5. The cells were then plated on appropriate selection medium as given below.
Selection of transformed cells
Reagents required
1. Ampicillin (100 mg/ml dissolved in 40% ethanol)

2. IPTG (20% in DMW and filter sterilized)
3. X-gal (2% in dimethylformamide)
4. LB Agar plates
Protocol
1. Pre-warm the LB-Agar plates to 37oC
2. Add 20 µl each of ampicillin, IPTG and X-gal and spread using a sterile bent glass rod.
3. To each plate, add 100 µl of the transformed cells and spread gently using sterile
bent glass rod.
4. Incubate the plates in inverted position overnight at 37°C.
5. The next day morning, pick the well isolated white colonies and prepare master plate
on LB-Agar-Amp plate and incubate overnight at 37°C.
Horizontal Slot Lysis
Slot-lysis is a simple and rapid technique to identify recombinant plasmids.

Colonies on the master plate can be screened by horizontal slot lysis to confirm the
presence of insert in the plasmid.
Reagents required
1. EndoR Stop Solution: 1% SDS/ 20 mM EDTA (pH 8.0)/ 0.25% bromophenol blue/ 30%
Glycerol
2. P II Solution: 1% SDS/ 0.2 N NaOH (prepared fresh)
3. TE buffer: 10 mM Tris/ 1mM EDTA (pH 8.0)
4. Solution X (2x): 4 volumes of P II and 1 volume of EndoR Stop Solution.
5. 0.5x TAE Buffer
Protocol
1. Prepare 1% agarose gel with 0.5 g/ml ethidium bromide in 0.5x TAE Buffer.
2. Pick up few cells of a colony using a sterile tip and suspend in 10 l of TE Buffer (pH
8.0).
3. Include appropriate control - cells that contain only empty vector.
4. To this suspension, add 10 l of the Solution X and load immediately onto the
agarose gel.
5. Electrophorese the gel at 40V for 30 min to allow the cells to lyse completely, then
increase the voltage and run at 80V until the tracking dye (bromophenol blue)
migrates to the bottom of the gel.
6. Visualize the gel under UV light and record the image using gel documentation
system.
7. Since the migration of the DNA molecules depends on size, the recombinant
plasmids having the insert migrate slowly compared to the empty vector that doesn’t
contain any insert.
Seperation of proteins on SDS-PAGE
Separation of Proteins on SDS-PAGE

Principle
SDS polyacrylamide gel electrophoresis (SDS-PAGE) involves the separation of

proteins based on their size. By heating the sample under denaturing and reducing
conditions, proteins become unfolded and coated with SDS detergent molecules,
acquiring a high net negative charge that is proportional to the length of the polypeptide
chain. When loaded onto a gel matrix and placed in an electric field, the negatively
charged protein molecules migrate towards the positively charged electrode and are
separated by a molecular sieving effect. After visualization by a protein-specific staining
technique, the size of a protein can be estimated by comparison of its migration distance
with that of a standard of known molecular weight. It is also possible to blot the
separated proteins onto a positively charged membrane and to probe with protein-
specific antibodies in a procedure termed western blotting.
Western blotting is a technique by which proteins can be transferred from a

polyacrylamide gel to a sheet of nitrocellulose in such a way that a faithful replica of the
original gel pattern is obtained. A wide variety of analytical procedures can then be
applied to immobilized protein, which makes western blotting a powerful tool for
diagnosing various pathological conditions. In this technique a sheet of nitrocellulose is
placed against the surface of a SDS-PAGE protein fractionation gel and a current applied
across the gel (at right angles to its face), thus causing the proteins to move out of the
gel and into the nitrocellulose where they bind firmly by non-covalent forces. The
technique involves three steps: protein separation by SDS-PAGE, blotting and
immunoassay.
SDS-Polyacrylamide Gel Electrophoresis

Reagents required
1. Acrylamide solution: 30 g acrylamide, 0.8 g bisacrylamide dissolved in TDW and

volume made upto 100 ml. Filter through Whatman No.1, and store in a dark
coloured bottle at 4oC.
2. Separating buffer: Dissolve 18.2 g Tris base in about 80 ml TDW. Adjust pH to 8.8
with 1 N HCl and make upto 100 ml with TDW.
3. Stacking buffer: Dissolve 6.1 g Tris base in about 80 ml TDW. Adjust pH to 6.8 with
1N HCl and make upto 100 ml with TDW.
4. Electrode buffer (5x): Dissolve 15 g Tris base, 72 g glycine in TDW and raise volume
to one litre. Dilute five times before use.
5. Ammonium persulfate (10%)
6. Tetraethylmethylene diamine (TEMED)
7. Composition of separating & stacking gels (10 ml)
Separating gel Stacking gel
7.5 % 10% 12% 5%
Acrylamide solution 2.5 ml 3.3 ml 4.0 ml 1.67 ml
Separating buffer 2.5 ml 2.5 ml 2.5 ml ---
Stacking buffer --- --- --- 2.5 ml
10% Ammonium persulphate 50 l 50l 50 l 50 l
TEMED 5 l 5 l 5 l 10 l
TDW 4.95 ml 4.1 ml 3.45 ml 5.77 ml
Composition of 4x sample buffer (10 ml)
Tris-HCl (0.5 M, pH 6.8) 1.2 ml
Glycerol 1.0 ml
Bromophenol blue 2.5 mg
Water 6.8 ml
i. Vertical slab-gel electrophoresis equipment
Tip Gel buffers and self-prepared acrylamide/bis-acrylamide stock solutions should be

filtered, degassed, and stored at 4°C.
Protocol
1. Assemble vertical slab gel apparatus using 1 mm spacers
Tip The plates should be thoroughly cleaned and dried before use.
2. Seal the glass plates on 3 sides with 1% agarose (if required).
3. Pour the separating gel mixture to a level approximately 2.5 cm below the top of
the glass plates. Gently layer 250 l of TDW over the gel surface. Allow to
polymerize.
Tip Prepare Ammonium persulfate solution freshly eact time it is required. As soon as
ammonium persulfate is added, the gel should be poured quickly before the
acrylamide polymerizes.
4. After polymerization is complete, remove water from the top, dry and pour
stacking gel mixture. Insert the comb between the plates and allow to
polymerize.
Tip With a marker pen, mark and/or number the positions of the wells before removing
the comb. This aids loading of samples.
5. On gel formation, fill both tanks with electrode buffer and remove the comb.
6. Sample preparation is done by mixing 3 vols of protein solution with 1 vol of 4 x

sample buffer. The maximum sample volume is determined by the slot capacity.
7. Vortex briefly and heat at 95°C for 5 min.
Tip During heating at 95°C, release pressure build up in tubes by briefly opening lids, or
piercing a small hole in the lid with a needle. After heating, samples should be
briefly centrifuged and vortexed.
8. Load the prepared samples into the wells in stacking gel by layering them under
electrode buffer using a microlitre syringe or micropipette.
9. Attach the leads to the unit and connect them to a power supply. Run the gel
under constant current conditions at 1 mA per slot.
10. Electrophoresis is continued until bromophenol blue dye reaches the bottom of
the gel.
11. Dismantle apparatus and remove gel from between the plates and place in a tray
containing distilled water. Cut a small corner of the gel to indicate the direction
of loading.
12. Stain the proteins using Coomassie Brilliant Blue R.
Coomassie Staining
Reagents required
Solution Composition of working solution
0.05% Coomassie Brilliant Blue R-250
40% (v/v) ethanol

Coomassie staining solution
10% (v/v) glacial acetic acid
50% (v/v) water
40% (v/v) ethanol
Destaining solution 10% (v/v) glacial acetic acid
50% (v/v) water
Protocol
1. Incubate the gel in Coomassie staining solution for between 30 min and 2 h with
gentle shaking. Coomassie Brilliant Blue R reacts nonspecifically with proteins.
2. Gently agitate the stained gel in destaining solution until the background
becomes clear (1–2 h).
Tip A folded paper towel placed in the destaining bath will soak up excess stain and
allow the re-use of destaining solution.
3. After destaining the proteins appear as blue bands against a clear gel
background. Typically, bands containing 50 ng protein can be visualized.
Fish Hematology – Identification of Blood Cells and their Differential and Total Count
Fish Hematology- Identification of Blood Cells and

their Differential and Total Count
Aim 1: To study the blood smear of fish
Materials: Grease free slides, Distilled water, Staining rack, Cell counter, Stains, Methanol,
Couplin jars
Procedure
Clean a microscopic slide with alcohol and wipe it dry with linen cloth. Fresh blood or
blood with anti-coagulant – EDTA/heparin can be used. Take a small drop of blood on slide
and take another slide and use it as a spreader. Just touch the drop of blood with the edge of
a spreader slide at an angle of around 35-45 °C and with a swift movement (don’t apply
pressure) make a smear by drawing the spreader up to the edge of the slide. A good smear
will be thick at one end and thinner at the other. Cells are to be counted where the smear is
not too thick or not too thin. Air-dry the smear and stain by any of the following method.
1. Giemsa staining
2. Wright staining
3. Pappenhein staining
4. Field staining
5. Leishman staining (fixing not required)
6. May Grunwald – Giemsa staining
Field staining
1. Air dry the smear
2. Fix it in methanol for 3 minutes

3. Stain with Field stain B for 5 seconds
4. Wash with distilled water for 2 – 3 seconds
5. Stain with Field stain A for 5 seconds

6. Wash with distilled water for 2-3 seconds
7. Air dry and observe under the high power under the microscope.
To prepare the Field’s stain, either use commercial stain powders or mix ingredients as
follows:
Solution A
 Methylene blue (medicinal) 0.8 g

 Azure I 0.5 g
 Disodium hydrogen phosphate (anhydrous) 5.0 g
 Potassium dihydrogen phosphate 6.25 g
 Distilled water 500 ml
Solution B
 Eosin 1.0 g
 Disodium hydrogen phosphate (anhydrous) 5.0 g
 Potassium dihydrogen phosphate 6.25 g
 Distilled water 500 ml
First, the phosphate salts are dissolved in separate containers. The stain is added to
each container. Leave each different solution for 24 hours, filter and keep in separate bottles
for subsequent use.
May Grunwald /Giemsa staining
Materials
 Smears of cells, fixed in methanol
 Giemsa buffer
 May – Grunwald stain
 Giemsa stain
 Staining racks and troughs
 Neutral mounting medium (DPX)
Method
1. Immerse the fixed cells in buffer for 5 min.
2. Transfer to May-Grunwald stain (freshly diluted 1:2 with buffer) for 5 min.
3. Rinse the slides in buffer and blot dry.
4. Stain in the Giemsa solution (freshly diluted with buffer) for 15 min Rinse in the buffer. Lf
the cells are overstained (too blue) allow them to stand in the buffer.
5. Air dry and examine under 40x or oil immersion
Phosphate buffer for Giemsa staining
 8 mM KH2PO4
 6 mM Na2HPO4
 Adjust to pH 7.0.
Different type of cells seen in fish blood smear
Erythrocytes
They are oval and biconcave in shape size ranges between 8 x 9.5 µ to 10 x14 µ and nucleated.
Nucleus is stained bluish violet by Giemsa stain. RBC’s are smaller in active fishes than in non-
active fishes. Deep sea fishes have larger RBC‘s.
Thrombocytes
They are oval, spindle shaped and nucleated and size ranges between 8 x 9 µ to 12 x 14 µ.
Nucleus is stained bluish violet. Cytoplasm is clear.
Leucocytes
Neutrophils: Circular or slightly oval in shape and size ranges between 9-13 µ. Nucleus is
lobed (2-3) and darkly stained. Neutrophilia is seen in pyogenic bacterial infection, infectious
dropsy and inflammation.
Eoslnophils : Size ranges from 7-11 µ. Cytoplasm granules are dark orange in colour. Nucleus
is bean shaped, oval or spectacled shape and bright violet in colour. Eosinophilia is seen in
parasitic infection and allergy.
Basophils : Circular or oval size ranges from 8-17 µ. Basophillc violet granules many in number
are seen which completely obscures the nucleus which is centrally located. Nucleus is often
irregular and eroded. Very rarely seen.
Lymphocytes : They are spherical. Small lymphocytes ranges between 4-8 µ and larger ones
ranges between 7-10 µ. They have large nucleus which completely fill the cells baring the light
cytoplasm near the edge.
Monocytes : They are oval or spherical, size range between 10-29 µ. Nucleus is centrally
located and it has a slight dent. Sometimes pale blue to rose fine granules are seen in the
cytoplasm. Monocytosis is observed in bacterial diseases.
Aim 2: To study the WBC leucocyte count of the given blood sample by Haemocytometer.
Materials
 Haemocytometer (Neubauer chamber)
 WBC pipette
 Dacie’s fluid
Method (A) dilution by using pipettes

Draw well mixed anti-coagulated blood in WBC pipette (with white bead) up to 0.5
mark and then draw Dacie’s fluid up to the 11 mark and wipe the pipette. (This will give 20
times dilution) Now shake the pipette well. Keep the coverslip which is provided with the
haemocytometer (Neubauer chamber) on the ruled area. Now discard a few drops of fluid and
charge the chamber carefully by placing the tip of the pipette at the edge of the coverslip and
gently allowing the fluid to flow down. This will be attracted under the coverslip by capillary
action. Avoid air bubbles. Count the cells under 40 X objective in the 4 squares (meant for
RBC count)
Method (B) tube dilution or bulk dilution
Take 380 µL of diluting fluid in a test-tube and add 20 µL of well mixed anti-coagulated
blood. Mix well gently and wait for five minutes. Now take a drop of blood and charge the
haemocytometer by the method shown above.
Calculation
Area of 1 square = 1 mm2
Total area counted = 4 mm2
Dilution =10/0.5 = 20
Depth = 0.1 mm
Number of WBC / mm3 = Number of cells counted x dilution

___________________________
Area counted x depth
Number of WBC / mm3 = No. of cells counted x 50
Image courtesy cell biology manual
Dacie's fluid (RBC diluting fluid)

The diluting fluid should be isotonic with blood so that no haemolysis occurs. lt should
prevent coagulation and fix the cell and retard bacterial and fungal growth in the fluid.
 Formaldehyde 10 ml (40%)
 Trisodium citrate 31.3 gm
 Brilliant cresyl blue 1 gm
 Distilled water 1 litre
 Filter it before use
Immunohistochemistry
Immunohistochemistry (IHC) method is routinely used to identify the presence and
location of antigens in tissue sections. Observing the antigen with respect to tissues would be
very useful in characterizing them. IHC is done with antibodies specific to the antigens and the
antibody-antigen interaction is visualized using chromogens or fluorophores. The basic steps
of the IHC-P are as follows.
1. Histology
1. 1 Fixation
Proper fixation is very important for the success of IHC. Immediately after dissection,
the targeted organs are put into a petridish containing appropriate fixatives (Neutral buffered
formalin or Davidson’s fixative). After that trim the organs into small pieces, fix them in
fixative in a 15 ml vial. After 24 hours, change the fixative and keep it for another 24 hours.
Avoid over fixing of tissues. Then change to 50% alcohol and keep it for 1 h (twice) and
immediately transfer to 70% alcohol and store until tissue processing.
1. 2 Dehydration
The tissues stored in 70% alcohol have to be passed through ascending series of
alcohol for dehydration. Dehydrate the tissues with 90% and 100% alcohol for 1 hr each two
changes.
1. 3 Clearing
After dehydration in alcohol series, the tissues have to be cleared in xylene for
removing the alcohol present in it for facilitating wax impregnation. Keep the tissues in xylene:
alcohol for 1h and then in xylene I for 1 hr and xylene II for 1 hr.
1. 4 Wax impregnation
Followed by clearing the alcohol with xylene, keep the tissues in 1:1 xylene: wax
mixture for 1 h. Then transfer the sections to molten wax (Melting point 56-58˚C) bath for
impregnation. Wax impregnation is for 2 h with two changes in between 1 h.
1. 5 Paraffin embedding
Tissue embedders are used for paraffin embedding. Embed the tissues by placing them
in an iron mould filled with molten embedding medium which is then allowed to solidify.
Commercially available tissue cassettes also can be used for paraffin embedding. Clean
paraffin wax which is free of dirt and any particulate matter should be used for embedding.
1. 6 Sectioning
Trim the paraffin blocks and section at 3-8 µm thickness. Stretch the ribbons in hot
water bath (40-45˚C) and only the properly stretched sections have to be mounted
onpositively charged slides or slides coated with adhesives like poly-L-lysine or APES. Store the
sections overnight at 37˚C for drying. Then store at 4˚C until staining.
1. 7 Haematoxylin and Eosin staining
Stain the sections with haematoxylin and eosin.Mount the slides with DPX and observe
under microscope. In the series of sections from single block, decide the slides with good
quality sections by H & E staining and good quality sections without staining were taken for
immunostaining.
2. Immunohistochemcial staining
2. 1 Deparaffinisation and rehydration
Dry the paraffin embedded sections at 56°C for 1 hr. Incubate the sections thrice in
xylene 5 minutes each. Use fresh xylene for each clearing. Then change the sections through
descending series of alcohol 100%, 90%, 70% and water each 5mins for 2 changes.
2. 2 Antigen retrieval (AR)

If AR is required, then place sections in staining jar with prepared AR solution of our
choice (Eg.EDTA buffer -10 mM citrate acid, pH 6 or Citrate buffer containing 9 mL of 0.1 M
citric acid, 41 mL of 0.1 M sodium citrate diluted to 500 ml with d/w) and heat the solutions at
90°C in a for 30 mins in water bath or keep in microwave oven operating at a frequency of
2.45 GHz and 600 W power setting for 5 mins twice.
2. 2 Masking free aldehyde groups
To remove the free aldehyde groups of fixative, treat the samples for 5 min with 50
mM NH4Cl in phosphate-buffered saline (PBS), adjust the pH to7.3. Then wash the sections
with PBS.
2. 3 Blocking
Blocking of endogenous enzyme is necessary if peroxidase conjugate is used for

immunohistochemical staining. Circle the sections with hydrophobic barrier pen (Dako pen or
PAP pen) and proceed further for blocking and immunostaining.Incubate the sections with
0.3% H2O2/methanol for 10 mins to block the endogenous peroxidase. Wash the slides in PBS
for 5mins. Incubate the sections with 10% Normal goat serum (serum from which the
secondary antibody is generated for better result) in PBS with 1% BSA for 20 minutes at
humidified chamber before incubation with primary antibody to decrease the background
staining. Remove the serum without washing by blotting.
2.4 Staining with antibody
After diluting the monoclonal antibody with the dilution buffer (standardised with
checkerboard titration), apply 100 µl of diluted antibody individually to each section after
decanting and tapping edge of slide to remove excess blocking reagent. Incubate the slides for
3 hrs at room temperature in a humid chamber or overnight at 4°C. Wash the sections gently
with PBS in a wash bottle. Keep the sections in PBS wash bath twice for 5 minutes (TBS must
be used for AP-labelled secondary antibodies). After washing the sections, add 100ul of
secondary antibody (Goat anti-mouse IGgHRP/ AP labelled or FITC conjugate diluted as
standardised) to the slides and incubate for 1 hr in a humid chamber at dark condition. Wash
the sections with PBS thrice for 5 minutes. Incubate the sections with an appropriate enzyme
substrate until optimal colour develops. Wash the sections with the same buffer and then
with distilled water. If needed counterstain the slides with appropriate stains (Chromogenic
counter stain - Haematoxylin,Nuclear fast red or Methyl green and Fluorescent counter stains
-DAPI (4', 6-diamidino-2-phenylindole), Hoechst or Propidium iodide), dehydrate (70%
ethanol, 95% ethanol, and 100% ethanol for 2 min per change), clear (xylene 3mins 2 changes)
the tissue sections.
2. 5 Reagent control
Normal mouse serum diluted with the dilution buffer was substituted for primary
antibody in immunostaining to differentiate the background and specific staining of the
primary antibody.
2. 6 Mounting
If fluorescent antibody is to be used for staining then treat the slides with 4%
formaldehyde in PBS for 5 mins before mounting in water-soluble media. This is done to block
the detachment of the fluorophore from the antibody. Mount the slides with anti-fading
mounting agent (Flour preserveTM, Fluoromount™, ImmunoHistoMount™). Store the slides at
4˚C at dark.
Reagents recipe
Phosphate-buffered formalin Davidsons fixative
Na2HPO4 6g 95% EtOH 330 ml

NaH2PO4 4g Formalin (37-39%) 220 ml
40% Formaldehyde 100 ml Glacial acetic acid 115 ml
Distilled water 900 ml Distilled water 335 ml
10x PBS (1M PBS, pH 7.4)

Na2HPO4 10.9g
NaH2PO4 3.2g
NaCl 90g
Distilled water 1000ml
Mix to dissolve and adjust pH to 7.4 Store this solution at room temperature. Dilute
1:10 with distilled water to obtain a 100 mM working solution before use and adjust pH if
necessary. Do not use PBS for alkaline phosphatase-conjugated antibodies, since phosphate is
an inhibitor of alkaline phosphatase.
10x TBS (1M TBS, pH 7.4)

Dissolve 121 g Tris Base and 90 g NaCl in 500 ml of distilled water Adjust pH to 7.4 with
approximately 200 - 300 ml 2 M HCl. Make up to 1 litre with distilled water Store this solution
at room temperature. Dilute 1:10 with distilled water to obtain a 100 mM working solution
before use, and adjust pH if necessary.
Peroxidase Blocking Solution (0.6% H2O2 in Methanol or PBS)
30% H2O2 1 ml
Methanol or PBS 50 ml
Mix well and store at 4°C. Block sections for 10 -15 min before or after primary
antibody incubation.
Blocking solution: 10% normal serum, 1% BSA in PBS pH 7. Mix well and store at 4°C.
0.001M EDTA buffer for antigen retrieval: EDTA3.84 g, Distilled water1800 ml, Adjust pH to
9.0 with 1 M NaOH
Flowchart for the Immunohistochemical staining of formalin fixed paraffin

embedded tissue sections
Deparaffinise the paraffin embedded tissue sections in xylene for 5 mins three changes
Rehydrate the sections through descending series of alcohol 100%, 90%, 70% and water each 5
mins for 2 changes.
Perform antigen retrieval (AR) if it is required or standardize through test battery approach
Treat the sections with 50 mM NH4Cl in phosphate-buffered saline (PBS) to mask free aldehyde
groups and wash the sections
Incubate the sections with 0.3% H2O2/methanol for 10 mins to block the endogenous peroxidase
and wash the sections with PBS
Block the sections with 10% normal serum in PBS with 1% BSA for 20 minutes at humidified
chamber and blot the sections
Incubate the slides with primary antibody for 3 hrs in a humid chamber or overnight at 4°C and
wash the sections twice for 5 minutes
Incubate the slides with secondary antibody for 1 hr in a humid chamber and wash the sections
with PBS thrice for 5 minutes
Incubate the sections with an appropriate enzyme substrate until optimal colour develops
Counterstain with appropriate stain and dehydrate (70% ethanol, 95% ethanol, and 100% ethanol
for 2 min each), clear (xylene 3 mins 2 changes) the tissue sections.
Mount and coverslip the tissue sections
Loop-mediated Isothermal Amplification (LAMP)
Loop-mediated isothermal amplification (LAMP):

Practical demonstration
Protocol: reaction mixture for 25 µl reaction
Components Working solution Final concentration Final volume(µl)

FIP 20µm 1.6 µm 2
BIP 20µm 1.6 µm 2
F3 5 µm 0.2 µm 1
B3 5 µm 0.2 µm 1
Buffer 10X 1X 2.5
dNTP 10mM each 1.4mM each 3.5
MgCl2 50mM 16 mM 8
Betaine 5M 0.4 mM 2
Bst Polymerase 8U/ µl 8U 1
Template 2
Total 25µl
Procedure
 Dispense 23µl of reaction mixture into each reaction tube except template.
 Add 2 µl of target DNA to each tube for positive reaction and add 2 µl of distilled
water to a tubefor a negative reaction making a total volume of 25 µl per tube
 Mix well by pipetting or tapping with the cap closed, and then spin down
 Incubate the reaction tubes at 630C for 60 min
 Incubate the reaction tube at 850C for 5 min for enzyme inactivation and to stop
the reaction.
 To confirm the amplification of target DNA, 5 µl of the product is applied to
electrophoresis at 100 V for 40 min in the 2.5% agarose gel and 0.5 X TAE buffer
 The gel is stained with 1 mg /ml of ethidium bromide and observed under UV light.

DBT-HRD Training Manual

Uploaded by

Copyright:

Available Formats

DBT-HRD Training Manual

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

DBT-HRD Training Manual

Uploaded by

Copyright:

Available Formats

Isolation of Genomic DNA

Isolation of Genomic DNA

Genomic DNA constitutes the total genetic information of an organism. The

General Remarks on Handling Genomic DNA

DNA is a relatively stable molecule. However, introduction of nucleases to DNA

An anticoagulant should be added to blood samples that will be stored. For

1. EDTA stock solution (0.5M, pH 8.0)

Dissolve 18.612 g of EDTA.2H2O in 50 ml of dH20. Stir vigorously on a magnetic

2. Tris buffer stock solution (1M, pH 8.0)

3. Sodium chloride (5M)

5. TE (10 mM Tris and 1 mM EDTA)

6. 10% SDS: Dissolve 10 g of SDS in 100 ml of autoclaved dH20.

7. 70% ethanol: Mix 70 ml ethanol with 30 ml of autoclaved dH20.

8. Chloroform: isoamyl alcohol (24:1) Mix :

Add 96 ml of Chloroform with 4 ml of Isoamyl alcohol.

9. Proteinase K: 20 mg / ml in autoclaved dH20. Store at - 20C.

11. Tris saturated phenol

Take 1.25 ml of 1M Tris, pH 8.0, in measuring flask and make up to 125 ml by

Hydroxyquinoline - is an antioxidant and a weak chelator of metal ions. In

1. Take 200 l of blood sample (stored in methanol) in a separate eppendorf tube

3. Suspend the cells in 500 l of TEN buffer.

Animal tissues and cell culture

3. To each tube, add equal volume of Phenol:chloroform-isoamyl alcohol (25:24:1)

4. Centrifuge the tubes at 10,000 rpm for 10 minutes at 4ºC.

8. Add 0.6–0.7 volumes of room-temperature isopropanol to the DNA solution and

Tip Use all solutions at room temperature to minimize co-precipitation of salt.

9. The tubes are centrifuged at 10,000 for 10 minutes.

11. Air dry the DNA pellet for 15-20 minutes.

Tip High-molecular-weight DNA, such as genomic DNA, should be redissolved very

Isolation of Environmental DNA (eDNA)

Environmental DNA (eDNA) is genetic material obtained directly from

General Remarks on Handling Genomic DNA

Obtaining information of species, populations and communities by retrieving

CTAB (Cetyl trimethylammonium bromide) being a quaternary cationic surfactant

3. 20% SDS: Dissolve 20 g of SDS in 100 ml of autoclaved dH20.

4. 70% ethanol: Mix 70 ml ethanol with 30 ml of autoclaved dH20.

5. Chloroform: isoamyl alcohol (24:1) Mix :

Add 96 ml of Chloroform with 4 ml of Isoamyl alcohol.

7. TAE (1x) buffer:

6. Centrifuge the samples at 5000 rpm in room temperature for 15 minutes.

Note: Weight difference may lead to dispersed pellet formation in centrifugation. So

RNA is a biological macromolecule that serves a number of different functions.

General Remarks on Handling RNA

Proper microbiological, aseptic technique should always be used when working

The use of sterile, disposable polypropylene tubes is recommended when

Non-disposable plasticware should be thoroughly rinsed with 0.1 M NaOH, 1 mM

1. Add 0.1 ml DEPC to 100 ml of the solution to be treated. Shake vigorously to

Stabilization of RNA in biological samples

Once a biological sample is harvested, its RNA becomes extremely unstable.

1. TRI Reagent (Trizol)

4. 70% ethanol: Mix 70 ml ethanol with 30 ml of 0.1% DEPC-treated water.

3. Transfer the powdered tissue to a polypropylene tube containing 1 ml of ice cold

4. Homogenize the tissue with a homogenizer for 15-30 seconds at room

5. Incubate the homogenates for 5 min at room temperature to permit complete

8. To precipitate the RNA, add 0.25 volumes of isopropanol.

Quantification of Nucleic Acids

Purity of DNA / RNA

RNA preparations are recommended to be treated with DNase to eliminate

1 A260 Unit Concentration (µg/ml)