Skip to content

MetaProFi is a bloom filter based tool for storing and querying sequence data for accurate identification of functionally relevant genetic variants

License

Notifications You must be signed in to change notification settings

kalininalab/metaprofi

Repository files navigation

MetaProFi: An ultrafast chunked Bloom filter for storing and querying protein and nucleotide sequence data for accurate identification of functionally relevant genetic variants

  • MetaProFi enables building k-mer indexes and allows exact and approximate searching of sequences in a fast and efficient way
  • MetaProFi supports both protein and nucleotide (canonical) k-mer indexing
  • One can use metagenomic reads or contigs or assembled genomes or other protein sequences to search against the index
  • MetaProFi allows one to use nucleotide sequences to search against the protein index by performing a six frame translation internally and uses the translated sequences to search the index

MetaProFi Workflow

Installation

Install MetaProFi as a command line tool using pip

  • Requirement: Linux OS (64 bit)

  • Setup:

    • Install miniconda on Linux

      wget https://repo.anaconda.com/miniconda/Miniconda3-latest-Linux-x86_64.sh &&  Miniconda3-latest-Linux-x86_64.sh
    • Download this git repo

      git clone https://github.com/kalininalab/metaprofi.git
    • Install using pip

      conda create --name metaprofi python==3.8 pigz
      conda activate metaprofi
      pip install /path/to/metaprofi/git/repo/directory/

Usage

  • Run the following to get the list of available subcommands

    metaprofi -h
    
  • Run the following to get MetaProFi version info

    metaprofi --version
    

Available subcommands

Command Summary
build To build Bloom filter matrix and to create index store.
build-seq To build Bloom filter matrix (every sequence in the input file (FASTA/FASTQ (.GZ)) will be considered as a sample) and to create index store.
update To build Bloom filter matrix for the new samples and to append/update the index with the new data
update-seq To build Bloom filter matrix for the new samples (every sequence in the input file (FASTA/FASTQ (.GZ)) will be considered as a sample) and to append/update the index with the new data
build_matrix To build Bloom filter matrix
build_index To build the index
update_index To update index with the new data
search_index To search/query the index
summary Extracts summary about the data using the index store

General information

  1. Please make sure to use the hardware with the same endianness during the build, update, and query sessions. Mixing of these is not allowed in MetaProFi.

config.yml:

MetaProFi requires a config.yml file which can be downloaded from here
Note: MetaProFi requires same config used for building to be used during updates as well (can increase max_memory and nproc)

  • h => Number of hash functions to apply on each k-mer [required]
  • k => Size/Length of the k-mer [required]
  • m => Size of the Bloom filter to use [required]
  • nproc => Number of CPU cores to be used by MetaProFi [default: Number of available cores - 1]
  • max_memory => Maximum RAM to be used by MetaProFi [default: half of the available RAM]
    Note: max_memory should always be the same during initial build and updates as well
  • sequence_type => Type of the sequence used for building the index (aminoacid or nucleotide) [required]
    NOTE: sequence_type is used to determine the type of the index database and also to determine whether six-frame translation needs to be performed on the input during querying
  • output_directory => Path to the output directory for storing Bloom filter matrix, index and the query results (if the directory does not exist, it will be created) [required]
  • matrix_store_name => Name of the matrix store directory
  • index_store_name => Name of the index store directory

Subcommands and its parameters

build

Builds Bloom filter matrix and creates index

Positional Summary
input_file Input file containing lines each of which specifies a sample identifier and one or more compressed or uncompressed FASTA or FASTQ file path (refer here for format)
config_file Path to the configuration file
Example:
metaprofi build /path/to/input_file.txt /path/to/config.yml

build-seq

To build sequence level index (as an alternative to BLAST for example), every sequence in the input file (FASTA/FASTQ (.GZ)) will be considered as a sample and a Bloom filter per sequence will be created in the matrix

NOTE: Sample identifier will be extracted from the header of each sequence

Positional Summary
input_file Input file can be either a FASTA or a FASTQ (.GZ) file with one or more sequences
config_file Path to the configuration file
Example:
metaprofi build-seq /path/to/input_file.gz /path/to/config.yml

update

To build Bloom filter matrix for the new samples and then to append/update the index with the new data

NOTES

  1. Looks for the index store directory (index_store_name set in the config file) in the output_directory path set in the config file
  2. Do not forget to change the value of the matrix_store_name in the config file for the update
Positional Summary
input_file Input file containing lines each of which specifies a sample identifier and one or more compressed or uncompressed FASTA or FASTQ file path (refer here for format)
config_file Path to the configuration file
Example:
metaprofi update /path/to/input_file.txt /path/to/config.yml

update-seq

To build Bloom filter matrix for the new samples (every sequence in the input file (FASTA/FASTQ (.GZ)) will be considered as a sample) and then to append/update the index with the new data.

NOTES

  1. Sample identifier will be extracted from the header of each sequence
  2. Looks for the index store directory (index_store_name set in the config file) in the output_directory path set in the config file
  3. Do not forget to change the value of the matrix_store_name in the config file for the update
Positional Summary
input_file Input file can be either a FASTA or a FASTQ (.GZ) file with one or more sequences
config_file Path to the configuration file
Example:
metaprofi update-seq /path/to/input_file.gz /path/to/config.yml

build_matrix

Alternate function for build subcommand. This is used when one wants to create the Bloom filter matrix only and does not wish to create the index immediately.

Positional Summary
input_file Input file containing lines each of which specifies a sample identifier and one or more compressed or uncompressed FASTA or FASTQ file path (refer here for format)
config_file Path to the configuration file
Example:
metaprofi build_matrix /path/to/input_file.txt /path/to/config.yml

build_index

Alternate function for build subcommand. To use this one should first use the build_matrix subcommand and build the Bloom filter matrix and then use this subcommand to build the index.

NOTE: Looks for the matrix store directory (matrix_store_name set in the config file) in the output_directory path set in the config file

Positional Summary
config_file Path to the configuration file
Example:
metaprofi build_index /path/to/config.yml

update_index

To append/insert new data to the index. First, one should use the build_matrix subcommand to build the Bloom filter matrix for the new data and then use this subcommand to append/update the index with the new data.

NOTE: Looks for the matrix store directory (matrix_store_name set in the config file) and the index store directory (index_store_name set in the config file) in the output_directory path set in the config file

Positional Summary
config_file Path to the configuration file
Example:
metaprofi update_index /path/to/config.yml

search_index

Search/Query the sequence against the index

Positional Summary
config_file Path to the configuration file
Flags Summary Required Default
-s Provide an input sequence (nucleotides/aminoacids) to search against the index
NOTE: Use either -s or -f flag and not both
Yes (Check Note)* None
-f Provide an input FASTA/FASTQ (.GZ) file containing sequence(s) to search against the index
NOTE: Use either -s or -f flag and not both
Yes (Check Note)* None
-i Provide the type of the query sequence (e.g., nucleotide or aminoacid) Yes None
-t Provide a threshold value to invoke approximate search (e.g., 50)
NOTE: Number should be between 1 and 100
No 100
Example1: Search for a sequence where at least 50% of k-mers are found (approximate search)
metaprofi search_index -s 'AGCCGGCCCGCCCGCCCGGGTCTGACC' -i nucleotide -t 50

Example2: Search for a sequence where at least 75% of k-mers are found (approximate search)
metaprofi search_index -s 'HIMHLIHIRAFFLDYNIYCIHRFNQSHRA' -i aminoacid -t 75

Example3: Search for all sequences in the FASTA file (exact search)
metaprofi search_index -f input_protein.fasta -i aminoacid -t 100

Example4: Search for all sequences in the FASTQ file (exact search)
metaprofi search_index -f input_dna.fastq -i nucleotide -t 100

Results: Can be found in a file named 'metaprofi_query_results_<datetime>_t<threshold>.txt' in the output directory path set in the config file*

NOTE: sequence_type in the config file will be used to determine if we are searching against the aminoacid or nucleotide index and to determine whether six frame translation needs to be performed on the input if nucleotide query is used

summary

To get summary about the data

NOTE: Looks for the index store directory (index_store_name set in the config file) in the output_directory path set in the config file

Positional Summary
config_file Path to the configuration file
Example:
metaprofi summary /path/to/config.yml

Full example:

Create a MetaProFi index for all UniProt bacterial sequences

  • Download all bacterial protein sequences from UniProt

  • Process the sequences (Create one filename.fasta file per bacterial species and put all related sequences together)

  • Create a input file input_file.txt (.GZ supported)

    • One sample per line

    • Each line should contain only one sample identifier followed by the path of one or more compressed or uncompressed FASTA or FASTQ file(s)

    • Lines starting with a '#' will be considered as a comment and will be skipped/ignored

    • Different possible accepted input_file.txt example is given below

      # This line will be treated as a comment
      sample_id1: /path/to/filename1.FASTA; /path/to/filename2.FASTA; /path/to/filename3.FASTA
      sample_id2: /path/to/filename4.FASTA; /path/to/filename5.FASTA
      sample_id3: /path/to/filename6.FASTA
      
    • MetaProFi sorts (ascending) the samples in the input file based on their storage size

    • MetaProFi discards samples that does not contain at least one k-mer

    • MetaProFi discards sequences that are smaller than k-mer size

  • Prepare config.yml refer here

    • How to choose the size of the Bloom filter (m)

      # Example
      from math import ceil, log
      n = 10**5
      p = 0.01
      m = ceil((n * log(p)) / log(1 / pow(2, log(2))))
      
      where,
      n = Maximum number of k-mers expected in any dataset
      p = Probability of false positives (fraction between 0 and 1)
      NOTE: Smaller the probability of false positive (p) larger the size of the Bloom filter (m)
      
    • How to choose the number of hash functions (h)

      # Example
      from math import log
      m = 10**6
      n = 10**5
      h = round((m / n) * log(2))
      
      where,
      m = Size of the Bloom filter
      n = Maximum number of k-mers expected in any dataset
      
    • To find the size of the Bloom filter given the maximum number of k-mers expected in any dataset (n), number of hash functions (h) and the false positive rate (p)

      # Example
      from math import ceil, log, exp
      n = 10**5
      h = 2
      p = 0.01
      m = ceil(n * (-h / log(1 - exp(log(p) / h))))
      
      where,
      n = Maximum number of k-mers expected in any dataset
      p = Probability of false positives (fraction between 0 and 1)
      h = Number of hash functions to apply on each k-mer
      NOTE: Size of the Bloom filter is directly proportional to the amount of storage required in a regular Bloom filter (MetaProFi uses packed Bloom filters and compression algorithms to reduce the storage requirements)
      
    • To find the number of false positives per query given the expected number of samples (N), maximum number of acceptable false positives per query (pqmax), size of the k-mer (k), and shortest length of the query sequence to be used (qlmin)

      # Example
      N = 10**5
      k = 11
      pqmax = 10**-5
      qlmin = 50
      
      per_query_false_positives = N * ((pqmax / N) ** (1 / (qlmin - k + 1))) ** (qlmin - k + 1)
      
      where,
      N = The expected number of samples (datasets)
      pqmax = Maximum number of acceptable false positives per query
      k = Size of the k-mer
      qlmin = Shortest length of the query sequence to be used
      NOTE: qlmin must be greater than or equal to k
      
  • To build Bloom filter matrix and index

    metaprofi build /path/to/input_file.txt /path/to/config.yml
    

    NOTE: Alternately one can use build_matrix subcommand to build the Bloom filter matrix first and then use build_index subcommand to create the index later

  • To query the index refer the available examples in search_index subcommand

How to cite us

  • If you find this tool useful, please cite:
Sanjay K. Srikakulam, Sebastian Keller, Fawaz Dabbaghie, Robert Bals, Olga V. Kalinina MetaProFi: A protein-based Bloom filter for storing and querying sequence data for accurate identification of functionally relevant genetic variants. Submitted

About

MetaProFi is a bloom filter based tool for storing and querying sequence data for accurate identification of functionally relevant genetic variants

Resources

License

Stars

Watchers

Forks

Releases

No releases published

Packages

No packages published